GenePrediction:GLEAN_3048 Details

Name: GLEAN_3048
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:433387..436675 (+ strand)
Length: 3289
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:433387..436540 (+ strand)
Length: 3154
Type: CDS
Source: GLEAN
Position: GCSC_160:436611..436675 (+ strand)
Length: 65
>GLEAN_3048 class=GenePrediction position=GCSC_160:433387..436675 (+ strand)
ATGTTGAAGCGGGGACTGGCGGCATCACGGCTTCCCGGCCGGCTTCCTGGAGCTGCTGCCGTGGCGAGGCTGTCGGGTCG
GCGGACGACGAGCAGGCTGCCAGCAATTCCGTGGACATGTCGGCGGTGCTCACCGCGGGGTGTATCGACGAGTGCTGGAA
GCGCAGCAGCAGTGTCTTGGACGACGGCCAGCGCGTTTGCCAAATCATATCCGGCTCTGGACACGTTTGAGCGGCGCCAC
ATCGGGCCGGACGAGTCGGAGACGGAGGCGATGCTGAAGGCGCTGTCGCCCCCGGTAGCGAGCCTAGACGAGTTTGTGGC
ACAGGTGGTGCCGGCGGACATCCTGACAGAGCGGCCACTCTTCCCGAAGGCACAGTCAGGGCCGGGCGATGCGGTGACGC
GGGCGATCACGGAGGCGCTGCCGGAACACAAGGTACTAGCAGAGGCGCAGGCGGTGGCAGCGGAGAACGTGCTGGCGAGG
AGCTTCATTGGGGCGGGCTACTACGACACGCTAGTACCAGAGGTGATCAAGCTCAACGTGCTGGACAACCCGGCGTGGTA
CACGAGCTACACGCCGTACCAGCCGGAGATCAGCCAGGGACGGCTGGAGTCGCTGCTGAACTTCCAGACGCTGGTGACGG
ACATGACGGCGCTGCCGGTGGCAAACGCGAGCCTGCTGGACGAGGGCACAGCAGCTGCCGAGGCGGTGACGCTGTCTCTG
AACGTGCTGTCGACAGCACGGTCACGGCGAGCGGGCAAGACGTTTGTGGTGTCGCACCTGGTGCACCCGCAGACGTTGGC
GGTGCTGCGCGGGCGAGCAGACGGATTCGGCATCAAGGTGGACGTCCGGGACGTCGGGGCGGCAGACTTTGTGAGCTCAG
GCTTGGCAGAGATCGGCGAGGACTTGGTGGGCGTGCTGGTGCAATACCCGGACACAGAGGGCGGCGTGGTGGACTTCCGG
GCGCTGGCCGAGGGGGTGCACGCACACGGCGGACTGCTGAGCTGCGCGACGGACCTGCTGGCACTGACATTGCTGACGCC
ACCGGGCGAATGGGGGGCGGACATTGCGTTTGGCAGTGCACAGCGATTGGGCGTGCCGATGGGCTTTGGCGGGCCGCATG
CAGCTTTTTTTGCGGTGGCAGACAAGTATAAGCGCAAGATGCCAGGGCGGCTGATTGGAGTGTCGAAGGACCGGCTGGGA
GGCCGGGCGTTGCGGCTGGCGCTGCAGACACGCGAGCAGCACATCCGACGCGAGAAGGCGACGAGCAATGTGTGCACGGC
CCAGGCGCTTCTGGCCAACATGAACGCGCTATATGCCGTGTACCACGGGCCGGGTGGGTTGAAGGCGATAGCTGAACGGG
CGGTGCGCGGAGCGCGGATCCTGCAGCTGGCAGCGGAGAAGCTGGGACTGAAGGTCAAGGCAGCGCCGGTGTTTGACACG
TTTGTGATCCGCTGTGCGAACGGTCAGGCCGACCAGCTGCTGGCGGTGGCCGAAGCTCACGGGTGCAATCTGCGCAAGCT
GAGTGCGGACGAGGTGGGTGTCAGCGTGGACGAAGCCAAGAGCCACGACGACCTGCTGGCACTGATCGGGGCCTTTCACG
CGTTTGCGGGCATCAAGACCGGACTGGAGACGTTTGTGCATCACTTGCTGGTCGAGGCGGACGACATGGACGACTTGGAC
GAAATGGACGAGGTGCCTCTCATCCCCGAGCCGTTCCGGCGCACGTCGGCCTACCTGACACACCCCGTGTTCAACTCGCA
TCACTCGGAGACGGAGATGCTGCGGTACATTCACCATTTGCAGTCCAAGGATCTGTCGCTGGTGCACTCGATGATTCCGC
TGGGGTCGTGCACAATGAAGCTGAACGGGTCAGTCGAGATGGCGACGCTGCAGATGCCCGGCTTCGCTCAGCTACACCCG
TTCGTGCCGCGGGACCAGGCAACCGGCTATGGACGGCTGCTGGGCTGCCTCAAGGACCAGCTGCGCGACATCACCGGCAT
GGACGCGGTGTCGCTGCAGCCGAACTCGGGAGCTCAAGGCGAATTTGCGGGTCTGCGGGCCATCCGGCGGTTCCACGAGC
TGCGCGGCGACAAGTCACGTGATGTGTGTCTGATCCCGGTGTCAGCCCACGGCACCAACCCAGCATCGGCCGCGATGGCC
GGCCTGGCCGTAGTGCCGGTGCGCTGCGATGCCAAGACGGGCAACCTGGACCTGGACGACCTGGAAGCCAAGTGCGCCAA
GTACGCCGACCGGCTGGCGGCCATCATGATCACGTACCCGAGCACGTTTGGCGTGTTTGAGCCGGGCGTGCGGCAGGCTT
GCGACCTCGTGCATGCTCACGGCGGCCAGGTTTACATGGACGGTGCCAACATGAACGCACAGATTGGGCTCTGCTCGCCG
GGCGACATTGGCGCCGACGTGTGCCATCTGAACCTGCACAAGACCTTTTGCATTCCTCACGGTGGCGGCGGGCCGGGTTC
AGGGCCCATTTGCGTCAAGGAGCACCTGGCCGTGACCCTGCCGCCTGAGACGGACTACTTTATTGCCGACAGCGAGGGAA
CGGGAACGGCGCTGCCGGCCGTTAGCAGCGCGCCCTTTGGCAGTGCCAGCATCCTGCCGATCAGCTGGGCCTACAATCTG
CTGATGGGCGGCGCTGGTCTCAAGAAGGCGACCAAGCTGACGCTGCTCAACGCCAACTACCTGCTTAGCCGGCTGCAGCC
GCACTACCCGATCGTGTACACGAACGCGCGCGGCCGCTGCGCGCACGAGTTCATCCTCGACCTGCGACCCTTTCACGACT
CGGCCGGCATCGAGGCCATCGACGTAGCCAAGCGGCTGCAGGACTACGGCTTCCACGCGCCGACGATGAGCTGGCCTGTG
GCCAACACTCTGATGATCGAGCCGACCGAGAGCGAGAGCAAGGCCGAGCTAGACCGCTTTGTCGACGCCCTCGTCAGCAT
CCGCGCCGAGATCCGTGACGTCGAGGAAGGCCGTGCGCCGCGCGTCGGCAACGTCCTCAAGATGGCACCCCATCCCATTC
ACGACGTCGTCGGCGCCGCCTGGGACCGCCCCTACTCGGCCGAGACGGCCGTGTACCCGCTGCCGTATCTGCGCGAGAAG
AAGTTCTGGCCGTCGGTGGCCCGGGTGGATGATAGTGAGTCTTTTTTTTTTTTCCCTTCTTTTTCTTTCTTTTTTTCTTT
TTCTTCCTCCCACTAACAAAGCAGCCTACGGTGACCTCAACCTCTTCTGCACCTGTCCTCCCGTCGTGGACACGACCGGC
CAGGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62