GenePrediction:GLEAN_304 Details

Name: GLEAN_304
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:920082..921361 (+ strand)
Length: 1280
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:920082..920161 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_167:920214..921000 (+ strand)
Length: 787
Type: CDS
Source: GLEAN
Position: GCSC_167:921068..921361 (+ strand)
Length: 294
>GLEAN_304 class=GenePrediction position=GCSC_167:920082..921361 (+ strand)
ATGGTCAAGGAGTCGAAGCTCTACGACCAGCTGGCAATCAAGCCTGATGCCTCGCAAGATGAGATCAAGAAGGCTTACCG
GTAGGTTTTCCCATTGTTCCGACCGTTTGAACCGGCAGCTAATAATTTGCAGGAAAATGGCCCTGAAGTGGCACCCCGAC
AAGAACAAGAACAGTTCTGTGGCGGCGGAAAAGTTCAAGGAGTGTTCTCAAGCGTACGAGATCCTATCGGACCCAGAAAA
GAGAAAAGCCTACGATACCTACGGCCTCGAGTTCATCCTCCGAGGCGGAGCTCCGTACCCAGATCCTAACGAAGCCGGCG
GTGGTGGTGGCGGCAACCCGTTCGCTGGTGCCGGTGGGGTGCCTGGCGGGATGCCGGGCGGGTTCCAGGGCTTCAGCTTT
GGTGGGATGCCGGGTGGCGAGGGTGGTGGTGCGCGGACGTTCCGTTTCAGCACGGGCGGTGGCAACGGTCACAAGTTCAG
CAACCCGGAGACGATATTTGCAGAATTCATGCGTGGAGGAGCTGGTGGTGGTGGTGGAGGCGATGATGATTTTGGCGACA
TTTTCTCGAACATCAATGGCGGTGGTGGTGGGCCTAGGATGTCGCGCGGAGGTCACCCCGGCTTTGGTGGCGGCGGTGGG
GCTGATCCGTTTGGACGCAGCGCACGACAGCACACGCCGGAGGTGACGACAGTTGAGCGGCCGCTTCCAGTTTCGTTGGA
GGAGATGTTCAAGGGCACGACGAAGAAGATGAAGGTCAAGCGTAAGATGTTCGACGACAATGGCAAGCGGACGACGACAG
ACACAGTGCTGGAAGTGCCGATCAAGCCAGGCTTGAAGAAAGGCAGCAAGATCCACTTCAAGGGTGTCGGAGACCAGGAG
GAGGGCGGCCAGCAAGACCTTGTGTTCATTGTGGAAGAGGTAAGAGGATCCCGTTTTAAATATTATCAGGCACATGCGTG
GGCCAGGTTGATGCTGACTAAGATAGAAAAAACACCCGCTCTATACACGAGACGGCGACGACATCGTTCTCCCGATTGAC
CTCACGCTCAAAGAAGCGCTGACAGGGTGGAAGCGCACGGTGTCGACGATTGACGGCAAGCAGTTCAACATTGAAAAGTC
GGGACCGACACAACCGGGGTCAAGCGACAGCTACCCGTCACAGGGGATGCCGATATCGAAGAAACCGGGGCAGCGGGGCA
AATTTGTGGTCAAATACAACGTCAAGTTCCCGACTACGCTGACGGCTGACCAGAAGCACAAGTTGCGGGAGATTCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62