GenePrediction:GLEAN_3050 Details

Name: GLEAN_3050
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:455457..457306 (+ strand)
Length: 1850
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:455457..455521 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_160:455594..455673 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_160:455738..456318 (+ strand)
Length: 581
Type: CDS
Source: GLEAN
Position: GCSC_160:456381..456540 (+ strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_160:456612..457306 (+ strand)
Length: 695
>GLEAN_3050 class=GenePrediction position=GCSC_160:455457..457306 (+ strand)
ATGACGAATTACTCTACCATCTCGGCTGACTCGGGGAGATCAAGTCCTGGCGACATGTCAAGAAGGTATGTCCGCTCTCG
TCTCTCTCGTTCAGCTGGAGCATAACGTCTAGATCGATGGCTGACTATGCGTAGCAGACGACGAAGAGGCCGAAGCCCCA
AGGGCGGAGGCGGGGAGGCCTCGATGCTCAGCAGCATCATCAACCTCTTGAACACAAGTGCGCCAACCCATGCCGCTCCA
AAACTCCAAAACTCCAAATGCTGACGGCTGGTGGGATGTAGTCGTTGGCGCAGGAACCTTGGCAATGCCGGCAGCCATGT
CACACATGGGCGTTGTCCTCGGCACCGTCGTCATCATATGGGCCGGCATTACATCCGCCTTTGGCCTCTATCTTCAGTCT
CGCTGTGCTCGCTACCTCGACCGTGGACAGGCATCCTTCTTCGCCCTGTCGCAGATAACGTATCCCAATGCCGCTATCGT
TTTTGATACGGCGATTGCGATAAAGTGCTTTGGCGTTGGCGTCTCATACTTGATCATCATCGGCGACCTGATGCCGGGTG
TGACTCTTGGGTTCAGCAGCCACGCTGCCGATGTGCCCTACCTCGTTGACCGCAACTTCTGGATCACTGTCTTCATCCTA
TTCATCATCCCTCTCGCTTACCTGCGCCGCCTCGACTCACTCAAGTACACGAGTATTATCGCCCTCGTCGCCATCGGCTA
CCTCGTCGTCCTGGTCGTCTACCACTTTGCGTCTGACATTCCTACCGACCGTGGTGAAGTCCGTATCATTACGTGGGAAG
GCCCGGTCGCCATGCTGCGCAGCTTGCCCGTTGTGGTGTTTGCTTACACATGCCACCAGAACGTACGTTCTCCCACCGAC
AACCTGCCGGCAACCTGATACGAATGCAATCTAACGTTCTGCAGATGTTTTCCATCCTTAACGAGATCAAGGATACCTCG
CCTGCTAGTGTCGCGGGCGTCATTACCACCAGCATCGGCTCAGCTGCCTCGGTTTATATCCTCGTTGCTATCACGGGCTA
CCTGACCTTTGGAAGCCACGTCATTGGAAACATTGTCGCCATGTGTACGTTGCTAGTGCTTGACAGTCCGCCCTCTCTGT
TTTGGTTTATATCGTTTTGCTAATCCTCGGTTCAGACCCCCCTAATATCGCATCGACGATTGGCAAGGCTGCCATAGTTG
TCCTCGTCACCTTTAGTGTTCCTCTCCAGGTGCATCCCTGCCGTGCCTCTCTAGACGCCATTCTCAAGTGGCGACCGAAC
AAGGCGAAACGCAGCCTAGCTTCGTCTGCTAGCAGCAGCGTTATGTTGCCCACTGTGGCCCCCACTGACAGTCACGGATC
GCCCGTGGTGCCAATGTCGGATCTGCGCTTTGCGGCTCTCACCACAGTCATCATCATCTTCAGTTACCTCACCGCTCTGA
GCATGTCTAGCCTGGACCGCGTGCTTGCTTACATCGGCAGCACAGGCTCTACTTCCATCTCCTTTATCTTGCCCGGCCTT
TTCTTTTACAAGATCAGCGACCCAGACAGCATGCACCACCAGCGCCTCATGAAGGAGGACGATGACGCCGAAGCTGAATA
TGATTCCAGCGACGAAGACACCGAGATCAACCCAGACGAGGCTTCCCTCCTCTCAGGCGTGCCCCGTGGCAGCGACAATG
TAGGCGGCTTTCCGTCCCGGCGCCTGCGTAACCGGAAGAAGTGGCGCTGGGATCTGGAGCACCTGGAGCACGGCCTGCTC
CGAAAGATGGCTCTCGGCATCGCTATTTACGGCTTCCTTGTGATGATTGTGTGTCTCGTCTTGAACACCTTCTTTGGCGC
GTCCCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62