GenePrediction:GLEAN_3051 Details

Name: GLEAN_3051
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:458619..461783 (+ strand)
Length: 3165
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:458619..458796 (+ strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_160:459070..459770 (+ strand)
Length: 701
Type: CDS
Source: GLEAN
Position: GCSC_160:459876..461783 (+ strand)
Length: 1908
>GLEAN_3051 class=GenePrediction position=GCSC_160:458619..461783 (+ strand)
ATGCATATCCTGGCCTCCCTGGGTCTCCTTGCAGCATTGGCTATAGGAGTCATTTCTCAGGATGCGGCCCCATTCTGGAT
GGAGAGTATTGCTCACAGTGGAGTAGCAGCTTTCAACCCAGATAAGAGCTATGTCGTATTCCGAAATGTGAAAGACTACG
GCGCGAAAGGCGACGGAGGTAAGTGCAGAGTATACAGGAAACATTAGCAAGCAGGCATGAAAGCTAGTACTGAAAGCTCG
TGTGTAAATTAGTGACGGATGATACTGCTGCCATCAACCTGGCTATTAGCTCGGGCGGCAGATGTGGAGGGCCAACAGAT
TGTGTTGGATCGACGACCACTCCAGCCGTGGTCTATTTTCCACCAGGGTTAGAAACCCAAATTTCCATATCAGCAAGGCC
GTGAATACTGACAGGAAAAAAGGACATACATGATTTCATCCTCCATCATAGATTACTACTACACGCAGATTATTGGTGAC
CCCAGAGATATGCCAACCATTAAAGCTACAGCTGGGTTCATTGCAAACATCATTGGAATGCTAGATGGGGACCTTTATGT
GAGCGGAAAACTCAAATATACCTCGACCAATGTCTTCTTCCGGCAGTTACGCAACATTCGCTTCGACACAACTTCTGTCC
CTGGTTCTGTGACTGCCGTTCACTGGCCCTCAGCTCAAGCCACGTCAATTCAAAATTGCGTCTTCGTCCTCTCTCCAGAT
CCGAGCAAACACCACACCGGAATATTCATGGAAGAAGGAAGTGGGGGATTCCTCAACGACTTGGTCTTCTATGGTGGTGA
ATATGGTTGTCAGCTGGGCAGCCAGCAGTTTACTATGCGCAATCTGACATTCTTCAACGCACAGACAGCTATTTTCCAGA
TATGGAACTGGTCATGGACGTACAAGTCAATTTACGTGTATAACTGCCAAATTGGACTCAACATGAGTGGACCCGTCGTT
GGCTCTGTGGCGATACTCGATTCTGGCTTTTACAATACACCTACGGGAATCATCTCCGGGCGCTCGCCATCAACCCAGGA
AAATCCCGGCGCCGGCTCGCTTGTTTTAGAAAATGTTGTCTTTCGCAATGTCGATACTGCCGTCGTCGCACCACAAGGAA
CAGTGGTTAACGGGAACCCTTCAGGTTCTATTGTGCAGAAAGGATTTGCATTTGTCCGTATATCCATTTTCCGACGTAGC
CGAAGAGCATACTGCTCTCAACTAAGGCAACCAAATAGTGGCTAACACACGTACCAGGGAAATTTATACGCACCAACAGG
GCCGAGTGTTTACCAATCTTTTGATGAAGCATACTTTCCAGAGTTGAGAAGCCTTAAAATGGGCGGCAAGTACTTAGAGA
GGTCGAAGCCCCAGTATGAAAATGTTGCATCCAGCAATTTCTTGACTGCACGGGCATTTGGTGCAAAAGGAGACGGGGTC
ACGGATGACACAGCAGCACTAAATGCTTTGTTCCTCAACGCTTCGGCTGCATTCTCTCATAGTATTGCATTTGTTGATGC
TGGTTACTATTTGGTTACCGACACTGTGCGTATTCCACCAAACGTTCGCATCGTTGGGGAAGCACTGGCTGCTGTCATCA
TGGGCTCTGGGGCCAAATTCGAAAAAATGAGCGCACCTTATCCAGTTGTTCAAGTTGGGAGGCCCGGAGAGAAGGGTTAC
GTCGAATGGTCGGACATGATTGTCTCGACGCAAGGCCCAACCGCCGGAGCTGTGCTCATCGAGTACAACTTGGAGACACA
GACTGGGCCATGTGCAGCTATTTACCCGCCGTCCGGAATGTGGGATGTTCATGTGCGAGTTGGCGGTTTTGCTGGGTCCC
AGTTGCAGGTATCACAATGCGGCAAAACTCCCCAGCTAGCAAATTATGTCAACCCAGCTTGCGTGGCAGCATACCTGAGT
ATGCATATCACCCCTTTCGCAACCAACCTATACCTTGAAAATAATTGGTTCTGGGTTGCCGATCACGATATTGAAGACCC
TCAAGGTGCCCAGATTTCAGTTTTCGGTGGTCGCGGCCTGTTGATCGAATCACAGAAGGGTCATATTTGGCTTGTCGGTA
CAGCCGCTGAACATCATGTCAAGTACCAATACCAATTGGTCAAAACACACGATATTTGGATGGGGTTGATACAGACTGAA
GCACCATACTTTCAACCCAACCCAACTGCACCAGCACCATTCGATTTGGTTGACTCGAATCTTCACGACCCCGATTTTGT
CTCTGACTGTGCAGCTGAAAGCAGTGCTACTGCACAATTGCCCGGAAGCCCACCATGTGCCATGGCGTGGGGCTTGCGGA
TTGTCGATTCTCAAAACATCAGTATCTATGGGGCTGGCCTTTACTCATTCTTTAACAACTACGACACCTCGTGTAGTGCT
CCAGGAAATGGAGAGCACTGCCAAGCGCGCATGGTATATGTTGGCGTGTCCGAAAATAGAACCAACGGTATTGCAACGAA
AAAACAGGCCAAGTTCGATTCAGGGAGTGCTAGTACAGGAAATGTCGATGGCGCTGTTGTGCTGCTGAACGACACATCTG
ATTCAGCTACTTGGAATATGGCAGGTATCGAGATATACAACCTCAACACACTCGGCACAGTCAGCATGATAAACCGCCAA
GGTGCAGATGTGGCGTTGTACCACGAGAACATCGCTGGCTACACGTCATGTGTAGTACTATTCAAATTTTGGCAGAACGA
GACCTCAAGCGAGGCCATGCCAGTTTCACACAGAGCCGCAAATTCAGCATCTCTACGACTGGCGGTGGTCGCAACCAATT
TCTCTACGAATTTTGCATGCAACGAAGACCCGAACCAGCTCTGTAGTGAGAAAAAGTCACATAAGCTGCCATATCGGGTA
CTGCATGCGCCGAAGCCGGATGAGGTGGCCCGAAGCATTCTGCCTGTCTTGGACGGAGTTCCTAGACCTTTTAAGACCAG
CGAAGGTAACAACACGAGCAATGCGACGGTTCACGAACATGCCAACGTTGCCCGTGACAGTGTGCTGCAATTGACTACCG
ACGCGTCCACTTCTGGAAGTTCTGAAATGGGTACTTCAATCCTTACGCTCTCACCAACGCTTAGCGCACATTTTCCTGCT
CCTCTACCTTCACAGACAGATTGCGACTTTGACTACGCCTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62