GenePrediction:GLEAN_3052 Details

Name: GLEAN_3052
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:467719..468719 (+ strand)
Length: 1001
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:467719..468426 (+ strand)
Length: 708
Type: CDS
Source: GLEAN
Position: GCSC_160:468492..468719 (+ strand)
Length: 228
>GLEAN_3052 class=GenePrediction position=GCSC_160:467719..468719 (+ strand)
ATGATGCTGCCGACCCTTCCGGCGGTGTTACGGCAGCCTCTTGCCAGCCTGGGCAGTGCGGCATGGACCGCCGTTGCCGG
CACGGTGGCCGCGTACGGTGCGAGCAAGCTGTTGAACAGCCTGGTGCTCGGCAACCCGCTGGTGTCGGCTGGCCGGTCGT
GGGACTGGACCAAGGAGATTGTGCTAATTACGGGCGGCAGCAGCGGCATCGGGCGGGCGATGGTGGACGCGTTTGTGCAG
TACAATGTCCGAGTGGTCGTGCTGGACCAGCATCTGCCGGACGCGAAGAGGCCCTTTCCCGAGGGCGTGACGTTCTACGC
GGTCGACCTGACGGCAGAGGAGCATGTGCACACGGTTGCCGAGTGGGTGCGGCACGACGTCGGCGACCCGACGGTGCTGA
TCAACAACGCGGGCATCACGAATGGGGGGAAGTCGCTGTTCGAGCTGACAGCCGACGAGGTGCGGCGAGTGTTTGGCGTC
AACGCGATTGCGCCGATGACGATGGTGCGCGAGTTCGTGCCAGCTATGGCAGCGCGCGACCACGGCCATGTCGTGACGAT
GGCCAGCATGGCCAGTTTCGTCGTCATCGCCGGCAACGTCGACTACAGCTGCACCAAGGCGTCCGTGATGGCACTACACG
AGGGCCTCACGCAGGACCTCCGGCACCGCTACAATGCGAGGAGCGTGCGGACGACGTATGTTCTGTCGGTGCTTTGTACT
TTTGTGTGGTGTGTTGCTAACAGGTCAGAATCGTCCATCCCCTCTGGACACAGACACCGCTGCTTGGGGGCCTGACAGAG
ACAAGGGACTTTAACGATCATGTCTTGAAACCAGAGACTGTTGCCCTCGCCGTGGTCAAACAGGTGCTCAGCGGCTGCAG
CGGCCAGATTGTCCTGCCCCGGGCTATCTCTTGGGTGTCTATGATCCGGTCCTTTCCCTTTTGGCTGCAAGAGCGGATGC
GAGACTCCAAAGCCGATACTTTGAGAGCCTTGGCGACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62