GenePrediction:GLEAN_3053 Details

Name: GLEAN_3053
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:472765..474680 (+ strand)
Length: 1916
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:472765..474330 (+ strand)
Length: 1566
Type: CDS
Source: GLEAN
Position: GCSC_160:474396..474680 (+ strand)
Length: 285
>GLEAN_3053 class=GenePrediction position=GCSC_160:472765..474680 (+ strand)
ATGGTACACACCAATCTCGTCAGCGCAGCGGTGTCCGCAGCTTCTTCCAATTGGCCCTTCCGTCCTCGGGTCGCTTCGAC
AGGCTCATTTCAGTCTGGCGACATCACCCCTACTTTTGATCCCTACGAGCGCGCCGATCCCTCGAGCAGACAACGATCTG
CCGCGTCAGTGCACCGACCTTCCATCAGCAGATACCACACCTTCCCTACCTCCCCTCCCAAAGCTCCGTCCGAAAACACG
ACGCTGGACGATGGCGAAGAGGCGTCTTCGGGAACAGGCCAGCTCGGTCGTCGAGACACACGCCGCCGGGGTCATGGCCA
CGGCCGGAACAGTGGCCACAGCAGCCCGGGAGAGGTCACGCCCTTGCCGCTGAGACAGGTCGGCCTGCTGGCGATCCTGA
GCTTGGCAGAGCAGACTGCCCTCAACTCCATTGGGCCCTACCTACCCACCATGGTGTCGTCCTTTCCCGAGATCCCCAAG
GAGCAAATGGGCCTTTATGTCGGTCTCTTGGCTTCGGCCTTTGCTATGGCGCAGCTGACGACCAACCTGTTCTGGGGCTA
CCTTTCCGACATTGTCGGCCGCAAGCCCGTCATTCTGACCGGCTCCTCCTTGCTCATGCTCTGCTTCGGCCTCTTTGGCT
TTTGCACCCGCTACTGGCAGGTCGTCGTCATCCACATCGCCATGGGCCTGCTCAACGGCAATGCTGCTGTCGTGCCCACC
TGCCTCGGCGAGGTCACCGACCGCACAAACCAGAGCAGCGTCTTTGCCTGGCTCCCCGTCATATATTCCCTTGGCTCCAT
CACGGGGCCGGCGCTTGGCGGCCTGCTCGTCGCCAGCCCTGGGGCGAAATATCCCTTCCTCGGCCCCAATATTGCCGGCG
CCGTGCTACTTGGTCTTGCCGTCACAGTGCTGGCCATATGGTTCGACGAGACGCTGGAAAGCGTCGGCGTCGGGCAGAAC
CAATCCATCTCGGCCAGCCTGAGCCGCTTCTTCTCTGAGCTCTCCCCGGCAAAGAGCGCGACAGGAGAGTATCCCGAGAC
CGAAAGCCTGCTCTCTAGTCCCCAACAAGGCGACGATCCTGTGAGCAGCAGCGGCGACAGGGCCAGCAACGGTGGTCTTA
AGAGCTCCAAGCAGGTGTCCGTCTTCCGCCAGCTTCTCAACTACAAGACCGTCCTCCTGCTACTCACCTATCTCGTCTTT
CAGCTCTCCAACATCAGCTTCAACAGCCTGTATCCCATCTTTGCCTCTGCCGCAGAGCCGACGGGCCGCAATCTGCCTCC
TGAAGAGATCGGTCTTCTCCTGTCCTTTGCCGGACTTGCCACCATCTTTTTTCAGATTCTCGTCTTCCAGTCCTTACGCA
CGAAGATGGGCAATCTCGGCACCTACCGGGTCGCATTCTTTGGCCTGGCAGTATCCGGACTGGTGATGCCGTGGGTTGGG
CACAAGTACGACCGGCCATTGTTCGGCATCGCCAGCGGCGAGTGGTGGTTGTACGGCGAGATGGCTGCCGTCTTGGTGGT
CAAGAACATCTGCGCCGTCGGTGGATTATCCAGCGTGATGCTCTTGGTTCGTTGTTCTTACATACTACCCTCTCTTGTAG
GCATACTCTAACACGTCGCCCGCGTGCACAGATCACCAACTCGGCCCCTTCTAATGAAACACTTGGAACGCTGAACGGCA
TTGCGCAGACGCTTTCTGCTGCCGGCCGCAGTGTCGGACCGTTTGTGTCTGGCGCACTTTTCACGCTGTCGACTCGGCTT
CGTCCGAAAGGAGAACTACTGGCCTGGTGGATCTTTGGGGGCGTCGCGGTGTTCGGCTGGCTCGGCGGTCTGATGGTCTC
GGGCCGTGGCCTCGAGAGTGCGGATTGGCAGGAAGATGACGAAGATGACGAGCCAATAGACGAAGAAATAAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62