GenePrediction:GLEAN_3054 Details

Name: GLEAN_3054
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:476040..476752 (+ strand)
Length: 713
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:476040..476114 (+ strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_160:476184..476497 (+ strand)
Length: 314
Type: CDS
Source: GLEAN
Position: GCSC_160:476581..476752 (+ strand)
Length: 172
>GLEAN_3054 class=GenePrediction position=GCSC_160:476040..476752 (+ strand)
ATGTCTTCACGCTCGAGTCAGAAGGGCTCCAGCAGCAGCTCGCATTCGGGAGGAAAGAAGGCACGGTCCTCGCAAGTGCG
TGCAAGCAATACATAACTTATCTGATCCCCCTCATTTACTTACATGTTTTTCTGCCTCATACAGAAGTCCATCAAGCAGC
TCATTGAGTCCCTCGAGACCCACCGCGTCAACACGCTGACGGAGCTGTGCCGTATCGAAGGAGCGGCCGCTGCGTGTGAG
CATGAGGAAGACGCTCGTGCATTTCAGGAGCCGATGACGGCTGCCTGGGTCTACTACGTCGAGAGCAACCAGTTCCTGTC
GGAGCTGCGCGGCCTTACACCTAGCTACCCCTTTAGTGGCGATGTGTTGGCCGAGGCCCAGCGTCGGGTTCGGAATGACC
CAGACTCCAACCGGAGCTGGAACATGGCCTGGCTGTGTCTCTCCAAGATCTTCAACGAGTGAGCACGGCCCGTTTCCTTC
TTCTTGTTCTGCTTATTGGCAGTTGGTGGTGGGGTTGCTAAACATTTAAACCTGCTCGCAGTGGCCTCATCTCCTACTAC
GCAACGTCTGAGGCGAGCAAGCCAGAGATGTGGGCGGGTTATGAGCCCACACCGGAGGAGTGCGCACAGCTGGCCCAGTG
CTTCGAGTACGAGTGGACACAGGCAGTTACAACTATGCTGCGCCACTGGTCGGTACCTCCGACGTGCTATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62