GenePrediction:GLEAN_3055 Details

Name: GLEAN_3055
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:481812..482151 (+ strand)
Length: 340
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:481812..481889 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_160:481996..482151 (+ strand)
Length: 156
>GLEAN_3055 class=GenePrediction position=GCSC_160:481812..482151 (+ strand)
ATGCGAACGGAGCCAGAGACTGATTTTCAGAGCGAGTACCCGGCCGCCATCGAGGATATCGTCAGCGTGGTGGATCAGGT
GAAGCCGTCGTTGAAGGACAGCGAGCTTAAAAGGGACGGTCGACCGCGACTCTCCATTTTTCCTCTACACAACTTCAAAG
ATAGGCAACTTCACGCTGAACTAGCACTATGATTCTAGCGCCAAGTCTACTGAGCAGAACCTGTACCTCCCCATCCACAA
GCTGAACACGCTAGACGTGTTTGCTACTTCGAACCTCGGTGATCTAACGGGTTCGTCAGGAGCCGTGCGTAATCTCTTCT
CGTACGGCCGGCCACTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62