GenePrediction:GLEAN_3056 Details

Name: GLEAN_3056
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:483016..487081 (+ strand)
Length: 4066
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:483016..483130 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_160:483215..483384 (+ strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_160:483475..484181 (+ strand)
Length: 707
Type: CDS
Source: GLEAN
Position: GCSC_160:484240..484890 (+ strand)
Length: 651
Type: CDS
Source: GLEAN
Position: GCSC_160:484953..485023 (+ strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_160:485566..485653 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_160:485722..487081 (+ strand)
Length: 1360
>GLEAN_3056 class=GenePrediction position=GCSC_160:483016..487081 (+ strand)
ATGAAGACATCATCATTTCTCGGCAATGGTGGGCCAGCGGCTCTGGCTGCGGTCTGTTTCGGTCTGCTCAGTTCGGGCGT
CCGGTCGGAGACGGCGGAGCGTGACTTTCATATCGGTTGGGCGTATGCGAATCCAGATGATGCGTGCAACCGGCCGGTGA
TTGCGATCAACGGCGAGTGACCGCCGCCGCTGATCACAGCCTCGGTCGGTGATCGGCTCGTCCTCAACGTTTACAACGAG
CTGGGAAACGCGAGCACCAGCATCCACTTCCACGGCTTCTTTCAAAACGGCACCAACCACATGGACGGGGCTGTTGGTGT
GACCCAGTGTGGCATTCCACCGGATGAGTCCTTTACCTATGATATTGAGGTATGTCACGCAAGACGTCGAGAGCTAACCG
GAGCTCTGTTGGGAGCTCGCTGAGAGCTGATAAAGCTGACTCGCCTCTACTTTACGCAGCCAGGCACATACTGGTATCAT
GCACACAACAACGGCCAGTACCTGGACGGCTTGCGAGGAACGATTGTGGTGCACGACCCGGTCGGGCCCCACGAGGACCA
GTATGACGCCGAGATTGTGTTGAGCCTGTCAGATTGGTATCATCGGCTCAGCTCGGAGCTGCTGGGCGATCTGATCAGTC
CGGGGAACCCGACCGGGGCTGAGCCGGTGCCTCAAGCAGCGCTGCTGAACGACACACAGAACCTGCAGGTGCCGGTCGAG
CCGGGAAAGACGTATCTTGTTCACATCGCCAACGTGGCCGGCTTTGCCGCATTCCGCCTCTGGTTCGAGGGACATTCGAT
GCGCGTCGTCGAGGTGGACGGCGTCTGGACCGAGCCGGCCGATGCTTCCGTGCTCTACATCGCGGCCGCCCAGCGCTACA
GCGTCCTGCTAACGATGCGCAGCGACGCTGCGGCCAACTTTGCCATGGTTGCCGCCATGGACTGCGACCTGTTTGACGAC
ATCCCCGACGGCCTCGCTGCCAACGTCAGCGGCTGGTTGGTCTATGACAGGGCGAAGCCGCTGCCTGAACCAACGCCTCT
GGCCAGCTTCGACGACCTCGACGACTTTGGCCTCGTTCCCTACGATCGCCAGGCGCTGCTAGACCACGTTGACCTGACCA
TCACGCTGGCTGTCAAGATGGACAACCTCCGCGACGGGGCAAATTAGTATGAGATTCTGCCAGCTGAAACTTTTTGTTTT
CTTCCTAGTGCTGACACCTGCCAGCGCCTTTTTCAACGATCTGACCTACGTCGCCCCCAAGGTGCCCTCGCTCTATTCTG
CCCTGACGGTCGGCGCAGCCAACGCGACCAATTCGCGGGTCTACGGCACGTACGCCATCCCACAGGTGCTGCCACATCTC
GCCGTCGTCGAGGTTGTCGTCAACAACGGCGACGACGGCATGCACCCCTTCCACCTGCACGGTCACAATTTCCAGGTCGT
CTCGCGGTCTGCAGACGACGCCGGCGACTACAACAGCAACTCGCCTGCCCTTCCTGCCATTCCGATGCGTCGCGACACTG
TCTCTGTGTGCCCCAACGGCAACGTGGTCGTCCGGTTCCGCGCCGACAACCCCGGTGTCTGGCTGTTTCACTGCCATATC
GAGTGGCACATGGAACAGGGCCTCATCGCCACCTTTGTTGAGGCACCAGAAGCCTTGCAGGGCCTCTCGATCCCGCCCGA
CCACCTCGCCGCCTGTGCCGCCGCCGGAACGCCCACGGCTGGAAACGCCGCCGGAAACACGCACGATGTGCTCAATCCCC
ATGGCCAGAACAAGCCGCCGCCGCCACCACTGTACAGGCGCTTCACGTCAAAGGGCTACATCGCGCTCTTCTTCATCACC
GCTGTCGCCATGCTCGGCATGGCTTACATCGCCAAGTAAGCTGCGTGAACTACGCTATCTCTTCCACGGACACTCGCTAA
CACCAATTTAGTCACAGGCATAGCTTGATAAAGGCAGCCATAGAGGAGACGAGCATCGAGAGCCAGCCTTTGATACCGGA
GGAAGGGGGTTCAAAAGTGGTCTGATTACAAATGGAAAGACCGCTTAGCGTCTAATAGCCCTAGCGGTTGGTGATCACCA
CGCTATAAAGGTGCTGGCTTATCTTGTGTTTCACCCAGTCACAGTGCTTTTAGCGCTTCCCGTACGGTGAACCTCAGCAA
CAGCTGCAACACCCAGCACGTCATCCACGTCGATTGCGAATATGCATGGCCATTGACGAAAGTACGATGCAACCCCACGC
GCCATACGAAATGCATTCATGGTCTGAGACAAGCCGGCTGTCGGCCACTTTGCCATGGCGCATTGCTCCAGTTGGCGTAC
CCGAGCCGGCAAACGGTCGCCGTTGGCGGATCATTCGTCTGCATTATATTAGACCCATCCCGACCCATATCGAGCAGTCT
TGCTTCATACAAGTACCGTTCTCTGTCTACAGGGAGACGAGGTTCTATTTCATGTCTGTGATCAAATCAGTTGCCATTGT
GGGTGCTGGTGCCGCCGGTATGGAAGTTGGCCTCTCCGATTGTTCGTCACGGTGTTGATTGAGATTATAGGGGCGGCAGC
TGTGACGGCATTGGCCGCAGAGGAGCACTTCGACGTGATCAAGGTGTTTGAGAGGCGAGAAGATCCCGGTGGAACATGGT
CAGTGCATCATCGTACCGGTTCTTGGAAAATATGCGACCCGGTCTGACGGAGACGAAATATTGCAGGATCTACGACGCAG
TGCCTCCCAGCTTCGGCCTCACTCCGGGAGCTCTACCTCCTGTCATCGACAAGCCGTTGGCCATCCCATCAGCTTTGCCG
AGGACGACGACGCATTCGATGCAGGAGCGCTATGCGATCACGCCCATATACGACGATCTGACCACCAACGTACCCGAGAT
CGCCATGTCCCTCTCGGACCAGCGGTTTCCATACGGCCCCTTTGTCCCACACTGGATTCCGAAAAACTACATTCGCCAGT
ACATCTCGACCCACGGCCAGGACGGGCGTCTGGTCCTCAACACGACCGTCGAAGACATCACACGACTGCCGAATGCGAGC
AGTGAAAAGCACGACCGATGGCGCCTGACCCTGCGGCGCCATGACCTCACCCGCAACGTGGACGAGTGGTGGGAGGAGGA
GTTTGACGCCGTCATCCTGGCCAACGGACACTACTCTGTTCCGTATGTCCCGTTTGTGCCCGGCCTCGCCGACTATCTCG
AGCGATTTCCCGGCCGGGTGGTGCACTCCAAGACGTACCGCTCGCCGAAGCCGTTTGCTGGGAAGCGCGTCCTGGTGATC
GGCAACTCGGCGTCCGGCCACGACGTGACAGACCAGCTGCTCCGCTCCGGCCTAGTGAGGAGCCCACTCTACCAGTCGCG
CCGCTCAACCTCGCGCTGGGACGGCGATGAGCCGCCGGCCGGCCTCGTCTGGAAGCCCATCATCACCGAGTACACGTCGG
ACGGGACCATCATCTTTGCCGACGGATCGACTCTCGGCCCCAAGGACATCGACGTCATCGTCTACGCCACCGGTTACAAG
GCCTCGTATCCCTTTTGGAACGTCGAGGCCAACGGCCGGCCGCTGTACGACTACGACGCGAACCGCTTCGTCGGCACCTT
CCAGCACACCTTTGTGCACGACTTGGCCACGCTCGCCGTCATCGGCCTGCCGCGCACCCTGACCTTCCGCTCGTTCGAGT
ACCAGGCCATTGCCATTGCGCGCGTCTGGGCCGGCCGTGCGCGGCTGCCGCCTGAGGACGAGCAGCGCCGCTGGGAGAGC
GAGCGCGTGGCGCTGCGGAAGAAGGAGGACAAGAACTTTCACGACGTCGAGTGGGACTCTGGCGAGACCGCCGCCTACCT
CGACTTCCTCTTCCGTCTGGCCGGTCTCCCACAGCTCGACGGCAAGGGCAGGATTCCGCCAATCCTCGATGCCAAGACAC
GCTGGGCCATTGAGAATATCCGCAAGTATCCGCTAGGAGACCGGAAGGGCAGCCAGGATGGCAGCAAGGACGACGGCAGG
CCGTCGACAGATGAGCGCGGCTGGGTCGTTGTCGAGCAAAAGAAGGACTCGCTCACGTTCTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62