GenePrediction:GLEAN_3057 Details

Name: GLEAN_3057
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:500789..503883 (+ strand)
Length: 3095
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:500789..503739 (+ strand)
Length: 2951
Type: CDS
Source: GLEAN
Position: GCSC_160:503805..503883 (+ strand)
Length: 79
>GLEAN_3057 class=GenePrediction position=GCSC_160:500789..503883 (+ strand)
ATGAACCGCGACACAGATGTACGAAGCCGGACCGCGAGGGCCACCACATTCCGTCCCCAGCAGCGGCAGGGAGAGTCCCA
ATTCGGCTTTCCCAAGCCACAACTCAAGCTGCAGAGGCGACAGTCCAGTGGCTCGGTGACGTCAACGTCATCATTGACTT
CAAACAAATCAACTGTCGGCGTCGAATCTGATCAGGATGGAGCTCTGGCACGCCTGTCTCCTATGGCTCTACCTGGCCGC
CAGCCATCAACTCAGCTGTCTCGAATCCCTCGACCCAGAGTCCATTTCAATATACGCCCCGAGGTTCTGTTCCAGCCCCC
CACTTTCCCGGTCCCCTTGAAGACGCCTACTTCGAACATGATCCGGGTAGAGCCTGGTTACGCGAATTCCGAAGCATCAG
ACGATTCGACCTATCTTGCGCCTCCTCCACCAAAGCCTCAGACGCTTGCCATCAATTATGCTCCTTTGCGGAGCCGGCCT
ACCATCCGGTTCAGAGATCCGGATCCAGTCGAATCTGTGGCCGATAGCAAAAGCTCTGCCGTCTTTTCTGCGTCCGAGTA
TGAGGATGCCTCATCTTTCGTTTCGGACAGCTCACAAGCTACGACGGTGAGTACGGAATATTGCTACGAAGCACGATCCT
CGAGACGGCGATCTTTCTCTGGGACAGGCCAAGAACTGTACACCATGACTTCACCCTTATCTCGGCGAGCTCTGTCCCGG
ACCCCAACCAATCGCTACATTGACGAAAACCCAAACACCGACATCCAGGTTGAAACCAACTCCTCGTCTGGTAGAAACGC
TATTGCCAATGAACGACATGCCAAGGAGATGGCAAAGCTTGAGAAAAAGACAAACTACCTGGAAGAACAACATAGCATTC
TTTCAGCGGAACTCAAAGATACGATGAGCAAACTTCTGGCTACGAAGCTGGAAAAAGCGGACATCGAGAAGGAGCGTTCT
AAATTTGCCGACAAGGTTGAAGCTCTTCAGAAGAAAAACAAAACCTTTCATGAGGAGCTCGAGAACCATCGCCAAATCGA
AGAATCCTATCGTCAGGACTCTAAGCAGCATGCGAACAGGGCCACCCAGCTTCAAGGAGATTTGCATTCTGTAGAGGAAC
TTTTGACTCAGAAGAAGCGGGAGAACGCCGAACTTCACGACGATTTGAAAGCTGTAGAAAAGCTTCTGGCCCAGGAGAAG
TTGGCTAATAGGACTTTGCAAAAGGATTTGAGAGCGTTGGAAGAAGCTCTAGGCCAAGAGAAAATGGAAAGTACGACACT
ACAGGACGATCTACTGGCTGTCGAAGACGCCCTGGCTCGAGAGAAAACGGAAAGGAATGCACTGCAGGCGTCCAAGGAGG
CACTGGAGGAGTCGAAAGAGGCACTGAACGGGCTAAAGGTGGCATTGGAGGAGAGGTGCACAGAGCTGGAGAAGACGCAG
GAGCTTCTAGTGAAGGAAAAGTCTGAGATGCAATCCCTTTACGCAACGCGTTCCACGCTGGAAGTAAGGTACGCAGATTT
GGAAGGTCAAGTGTCTTCCGCTCGTGACACCCGAAAAGAGCTCCAGAGTGTTCTTCTGATGCAGATTTCCAATTTGGAAT
CGACTCGGGATGCTCTGAAGACGCGTCTCGATATCTTGGAGCAAAACCTGGCCGACAGGGGGGCCGAGCTCGAAAGCTGC
ACTGCTTCCCGTGACGAATATAAAGAGGAGGCAGAGAAGAAAGGCCTTGAGCTCGAGGCTTTTGAAGAAGAAAAATTGCA
GCGCGATGAGAGCTTTCAGCGGCTCGAGGAGTCGCTTGAAGAGCTAAAGGCAGCAAAACATGAGTTGCAGTCCAACGTTT
TGTCTCTGGAAACCGAGAAGCAATTCATCGCCGAATCATTGAAGAGACTCGAAGCGGAAAGGGCCGAATGGATTGCAGAG
CGGGAAATCCTCCAGGAGCACATTTCCGAGATCGAAAACCAAGTCAGTGGCCTTAAAGCTGAAGTTGAATCGAAGCAAAA
GGAGATCGATTCGCTATTCCGAGACAGAACTCGGCTTCAAGACGAAACCGGAGCTTTAAAATCCCAGCTATCAAACAAGG
AGAACGAAATGGAAAACAGTCTGAATGCTGAACGCCAGGAATCAGAGGCGACCATATCATCGCTAAACAGCACCATAAGC
CAACTCGAAGAGGATAAGGCAGCCCTCAGCTCGGACAAAGACACCATGTCTTCCGAAAACGCAACTCTCACTTCAGACAA
CGGACGTCTCAGTACAAAAGTCACATCTCTCACTACAGAGAATGCTTCTCTGGCTGAAAATAATGCTACCCTCACACTGG
AAATCGCAGCTCTCACGGAGCAGATTGCAACACTAACAACGGAGTGCTCGGCACTCGAAACGAAAACCGCAACACTCACT
ACGGAAAGTACTACGCTCATTACGGAAAACACTACACTCGTTGCAGAAAAGGCAGCTCTCGTTTCAGAGCTTGATAAGTT
AAAGGACGAATTGCCGGCCAAGACAGACAAAGAATTGGCTGAGAATCTTGCCGCACTAGAAAAGAAGCACGAAGAACTGT
GCAAGAAGTGGACTGAGCTCAGTGCCAAGAAAGATGCTCTGGAGAAGAGCAACCACGAAATCCTAGATGAGCGAGATAAG
CTACAACAACTAGCCGACAGCAATTCGGATCAGGTGGCGCGCCTGCAGCAAGAAGTCCAAAGATTAGAACCACTGCAGCA
TCAGCACGACATCCTGGCTGGTCAGCTTGCTGGTACAAGCGGTCAGCTGGGGCAGATCAGTGCAGCATATGCCACGTCTC
AGGATGAAATAGCTACCCTGCAAGGACAGCTGGCGACATTGCGTGCCCGGTCTACGTCCGAAAAGTCGGGAGGATCGTCC
GGCAAGAAAAAGGGAAAGTCATCAAAGGATGAACTTGTAATCGTACGAAACTCGTCAGACCGAAGATTATTGTAAGTGCT
ATTCCCGACCCAGATTGTTTACTTCCATTGCTGACATGAGTTCCTCACTTCAATAGCCAGGTTGTCAAAAAGTCTGATTT
ATACTCTTCTCGAAGCTCGTCTCGCAACTCACGCAAGTCGGACGAGGATTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62