GenePrediction:GLEAN_3058 Details

Name: GLEAN_3058
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:509147..510403 (+ strand)
Length: 1257
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:509147..509212 (+ strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_160:509397..509582 (+ strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_160:509645..510403 (+ strand)
Length: 759
>GLEAN_3058 class=GenePrediction position=GCSC_160:509147..510403 (+ strand)
ATGTCGCTGGAAGTTTGGCCACATCTCCCCTTTGCGGAACTACAAAAGGAGCTTCAGGCGACCGAGGTATGCAGTCTTTG
TTCTTCTATGCGCAACAATGTCAATTCTTCCAGAAGCTACGTCCTGGCTTCTCGTGGTTGTCTTTCCAGGGACTGGCTTG
TGTGCCAAAGCACCGTATTGCCTCCGCAATGAGAGCTTGTGCGATGGTGGGAAATATGAGATGCTGACCAGAGTGGGTGC
CGGCTTGCAGAAGCGAGAGTTGGACTGGCAGCTCGACGAACTGAGGGAAACTCTCACGAACCTGAAGCAGAGCCTTGAAG
ACTGCTACAAGCTGCTCGGCCCCGATGGTAACGGAAACACGCTTGTCGTGAGCACGCCTCGAAACGAGGCTGTCAAGGGC
CACATCACACGGCTCGGCACCCAGATTGTTAGAGGGGTAGGCAAGACTCTTACTCGTGTCTCTCATTGCGCCTCCTCCTG
TCGCTGACCCAGTCCCAGAGCATGCACATCCGCCTCCGGACGCTTCCCCACCAGACCCTGACCATTGATCCTCGGCAACC
CATCACCATCGGCCCTCTCGCTGCTCTGCACACGCTTCTCACCCGCTCCATTGACCTCCTGGCCCTGACCCTGGCGTACT
CCTATCCGCCGCCACGGTCGCCGCCTGGAGAGCCAGGAACATTACCACTGCATGGAAGAAACGATACCTTTATTTCCACA
CAGCTCCGGGTGCTCGCACAGGCTCTCACCGATGCTCTGGCTCTCCTCAAGGGCCCAGCCCCCACGCCAGGCGATCCCGC
ATGGTCTACGCGGTCGGTGTCGTTGTCCCACTTCTCGCCGGCGCTGCCGTCTGCCGTCAGCTTCTACATCGGCCTTCAGG
ACAGCCAGCTGGTCCTCTGGCTGCGTGCCGTCGAGCCCGTCGGCGTCCCTCTCAATTTCGGGATGAAGTTTGCCCTGGCT
CTTGGAACTGCTCGCCGTATCGAGCATGACGAGGCCGACAAGGTGTTCACGTACAGCTGTGAGGATGGCACGGCCAAGGG
CCTGCACTCACCACAGCCGGCTGGAAGTGCCACGTCCGACGTGGATGAGCCAAGACCCGAGGGGCCGGCTGAGGTCTATG
TCCGGGAAAAGGTTCGAATAGAAAGTGCAGACCCTAGCTTGATGAGCTTGAGCGCCAAGCTCGGTGCTTTGAATCATGCC
CTACTTCTGGTACGCCGAAATCTTGCGGCCGTCATGGGCGAGGAGCTGGAGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62