GenePrediction:GLEAN_3059 Details

Name: GLEAN_3059
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:512409..514113 (+ strand)
Length: 1705
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:512409..512457 (+ strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_160:512520..512600 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_160:512668..512698 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_160:513044..513261 (+ strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_160:513332..514113 (+ strand)
Length: 782
>GLEAN_3059 class=GenePrediction position=GCSC_160:512409..514113 (+ strand)
ATGTCTTGGTTCGGTGTTGCCCCGCTGAAAAAGTTCCCGGCGCCTTTCCGTACGTCAATGGCTCCCCATTTGCCTTCCAG
CAGTCCGAGCTGCCTGCTAACAAGTCCTCAGTGCGGCCGTACGGGCCGTTCTTCGCCGCCGGCATTGTCATCGCCTATGG
CGTGAATTCGGCACAGAACGCCCTTTCGCAGAGTACGTGTGACGGCCAATTCCTCCTCCGGAGACAGTCTTGCTGACTTT
CCTTTTTCCCTTCCAACAGCGGCCGAGTGGAAGAACGACCCGAGAAACGTGTACGCAAAGGCGGACAAGCACTAAACACG
GCCTGGAGCAAGGATTGGGGGGCTGCTATGAGTCCGGTGTACGGCATCAGACGCCTTGCTCTGCTTGGCCGTGCAAAGCG
GCAAGGTTAAAAATGTAAATTAAAACTCTGCAAGGTACAAATCATGTGTGCTTGACAGTCAGAAGAAGCCGTGAGAATGA
GAGTGTAGAATGCACGTGTCTTGCAGTAGAGGCTTGAGCGGACGCCGGACAAGCCGATTCGGTCTTTGGCCGACGGGTGA
CTCATTAGCGAGCGGCGATTGATTTCTCGGCCCGAGGGCAACGTGAACTGTCGCAGCCGAACACAACCACCGCAGGAGAC
GAGTCTTGATTTTCCCCCGCACAACCATCGACGGCGTCTTTCACTACATGACATCCTGTGCGGTCCTATTCTGCCGATTC
CGTGCGCGAAACGCCCTGCCGCTGTACAGCCGCACAATAGCGACGATGGCGACGATGGCGACGATGGGGAAGAAGCCAGG
CGCGCCGAAGCCGGCGGTGCCGAAGAAGGACGTCAAGATTTTGATGCTGCACGGTGAGCGGCTGCCGTGTCAATATTGTC
GACTGTGGCGTCAGGCCGCCCGCTGACGTGGCCCGCCGTCAAGGATACACCCAGTCGGGACCGTCGTTTCGCAGCAAGAC
GCGCGCGCTCGAGAAGCTGCTGCAGAAGCAGCTGGCGCCCCACAACCTGATGCCGGTGCTGATCTACCCGACGGCGCCGA
TCCGGCTGCAGCCCCGGGACATCCCCGGCTACCAGCCGCAGACGCGAGAGGGTGCCGGCGACGACGACACGACGCCCGAA
GAGGCAGACGCGTGGGCCTGGTGGCGCTTTGACGAGGCTTCGGGCACGTATCGCTTCTTCGACGAGGGCATGATGTCGCT
GGCCGGTCCCATCGCCGCGGCCGGTGGCATCGACGGTGTCCTCGGCTTCAGCCAGGGCGGCGCGCTCGCTGCCCTTCTCG
CGGCCGCCCTCGAACAGCCGCCGCGGACTCAGCGGTCGTCGTCATCGTCGTCATCGTCCAACGACACACCTGCCAACTCG
CCCTGGGTTGATGCCGTGCGCGCGGCCAACAACCAGAGCGGCCTCCAGTTCGCCGTCATCTACAGCGGCTTCTACACCCC
GCCCGAAGATGTCGCCTGGCTGCTCGAGCCCGCCATCCGCACGCCCACGCTGCAGTACATCGGCAGCCTCGACACCGTCG
TCGACGAGAGCCGCAGCCAGGCCCTGATCGACCGGTGCGTCGATGCCGCCGTCGTCATCCACCCTGGCGGCCACTTTGTG
CCTGTCAGCAAGCAGTGGATCATGCCGCTGGTCGGCTTCATCAAGGATCACGTCCAAGAACCTGGGCCCGAGGCTGAGGT
TGAACCCATTAAGGCGAAAGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62