GenePrediction:GLEAN_305 Details

Name: GLEAN_305
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:925034..927060 (+ strand)
Length: 2027
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:925034..925069 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_167:925182..925523 (+ strand)
Length: 342
Type: CDS
Source: GLEAN
Position: GCSC_167:925594..925757 (+ strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_167:925809..927060 (+ strand)
Length: 1252
>GLEAN_305 class=GenePrediction position=GCSC_167:925034..927060 (+ strand)
ATGACCAAGCTCGGTCCCTTGACGTCGCAAGCGTTGGTAAGATTGGTTTTCGTTTATCTTTCTCATTCTGTGCCGTTTTC
TCTATTCCTCTCCTCTTTGTACCTGTCTCTCTTTCTCACGTCTTCCCCTCCCTCTCTAACGTCTTCAGGGCCGCTCGCCC
TACGACATTGTCGTCCCGGGCGAGGGCGAGCAGGATCCACGAGATCACGATCCGAACCAGCACCGACAAGAATACGACGA
CCGCGGACGACCGGTCAACAGGGAAACCAAGCTGATGAACCGTGACATTGTGCGCGCCCACAACGAGGTCATGCAGGTCA
TCGGTGTAGCCGAACCCGACAGCAGCATCCAGGCAGCTGACGAGGAGGCCGAGAAGCGCTACCGCCAGAAGCAGTACGGC
GACGAGGTTGCGCACCGGCTGATTCACGTGGGCCGCGTCCTGGGCGTCATGGGCGTCTGGGGCGTCAACGCCGTGCGCCA
GCGCATTTTGGTAAGTCGTGCGTTTTCCCGGTTTTCTTGCCTCACTTCAGCACCGTCGCTGACTCGCACTCTCGCTCCAG
CTCTACCGCCAGTACTCGGAGATACCGTTCCATCACCTGCTTCAGCACGAGTTCAGCCGCCAGCCCCTCTGGCGCGCCCT
CGAGACCGGATTGCCCGTCTTTATCACCAACCACGCTCTTCGTCGGGCTTCTCTCGGCTTCAAATCGGTCCACAGAACCT
TCTGGTGCGCTTGCGTTCTTTTTTCATTCTTCCGAGACTTGCTAACTGTTGCCAGGAAATCCTCCCTCCTCCAGTTTGTA
CGCCTGCATCTGCAGATGTTCCTCTTCCTGCAGCGCTCCGGCATCGCGCCGGCTGTGCCGTTACTGCCAAGCCCGCTCTA
CTTTCTGCCCTTCTCCCGCGAATCGCCCATTGCAAGACCACCTCCGCTACCGACGACGCTGTCCGTCCGCTCCATGGTCC
ACTGGAGCTGCGCCACCGTCCTCAACTTCGCCCCCGTCTTCATGTTCTATAGCTATATGCGAGCATGGTCTTACGTGACG
GAAACGCTCTACAGAAGGATCTACCACTGGCTGCCGACACCGACAAACCCACGTTCGTCGCGCAGCCTATACGTGCCCGA
GTACGTCTCAATCAGCGCAAGACGGCTAAACGGTTCATCCGCAGCCGAGGCCAGTGATGGTGCCGATGGTGCAGAAGACA
TGGACGGTCCGATTGGTCCAGACGACGTGGATACAGCAGCCGCATCGTCCGAGTCCACGCCGCTGCAACCGCTTCCTCCT
CCACCACCGCCGTCGTCTTCGGCACCCGGGTCACCCACGACGGTCCGCCGACGAAACACGGTCTCGAGCCATGGTGGGGG
CGACGACGGCTACGCGAGCGAGGAGGAGGAGTTTGAGCTGAGCGCGACGCTGATCAGCTTCGATGTCGAGGCCGGCGACG
CCAACGACAACGCGCCCAGCGCCTGGTCGGCCGAACTGCGACAGAGTCCCGCTGGCGGCGGAGAGGGTGGACCGGCCGGC
AACGGTGGTGACGTCGAAGGAGGCGAAGGCCGAGGAGAAAGTGGCCATCAAGGGACCAGCGGCTCGGACTATGGTGTCGG
CGACAGCAGCAACGCGACTTCTGGAGTTGGCTTCGGGCCCGTCTATGCCGAAGGGTTGCTGGTACAGCTGCCGGCCATCA
TCGCAACGGACATCATGACAGTGCTGACTTCGTCGGCCCTGATGGCGCCCTATGAGGCCTTTATGATCCGGCTGGTGGCG
CATGCCTATCGGCAACAGCACGGGCTGCCAGTCGACGACCTGTACGGACTCGCCGTGCTGTCGCCGGCCGACGGCAGCCT
CTCGTGGACATCGCTGACCAACTGCGTCGGCATGTGGCTGGTGCACCTGGCCGTCGACGCGAGCGGCTGGCTGCTGGTCA
CCGGGCTGGCCGTGCTGTATCGGGGTGCTGAGCCGGAATGGTCTATTTTCCAGCTGCTCAAGGAGAAGCTGGGATACGGG
CAAAAGCGAGGGGATGGACGGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62