GenePrediction:GLEAN_3060 Details

Name: GLEAN_3060
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:516370..517664 (+ strand)
Length: 1295
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:516370..516439 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_160:516531..516842 (+ strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_160:516937..517152 (+ strand)
Length: 216
Type: CDS
Source: GLEAN
Position: GCSC_160:517211..517575 (+ strand)
Length: 365
Type: CDS
Source: GLEAN
Position: GCSC_160:517629..517664 (+ strand)
Length: 36
>GLEAN_3060 class=GenePrediction position=GCSC_160:516370..517664 (+ strand)
ATGACTTCTCGAGGGCGATCCCCACTCCCGCAATACGACATTCGTTCTCCGTCTCGGTCAGCGTCGCGAGGTCGCAGTCG
GCCGCATTCTTTCTCTCCCAAACCCGGTCATTCTCGTTCAAACTCGCCGCTGCAACAACGATATTCTCGCTCGCCCTCTA
GATACGGTGGAGGCTCTGCTTCTCCACCAGGACGTGGAACTGAACATCGGCATGATAGCCTTGTCGCCGGCCGGGATTCT
AACCGGCACAGCAAGGTCGGCGGCCGGAGCAGAAGCGCTACGCCTGTCCGAAGCACAAAAGTTAGCAGCAAACGCTCGCT
TGGTGATGCGTCACGAGGCCGCCGCTAATTTGGACATGTATGCACAGATTGTTGTAGAGCGACTCACAAAGAACGTTAAT
GAGGACCATTTGTACGAAATATTCGGCCAGTTCGGACACATTCGCGACCTTGATCTACCTATTAGTCGCATATGTAAGCG
CAACGGCTCAAGGAAACCCGTTATTGCGATGCACTCCTGTTGTTCATCTCCATCTTCTGCTCGGGGCTGACTCTCGCTTT
CATGCAGCTGGTACAAACCGCGGAACTGCTTACATCCTTTATGTGGAGGAGCTGGACGCCGAAGCTGCGATTGCACACAT
GCACGAGGCACAGCTCGATGGCGCCACCATCAACGTCTCTATTGTTCTTCCACGCCAGAAGTTCTCTCCCCCACCGCCGC
TTGCTGCAAGACGTGGCGGTGGTTTCAATAACCGGAACGCTCCCAACGCAGCTCCACGAGGAGGTCGCGGGCGGAGATCG
CCCGGTCGTTTTGGCAACTCCCGTAACTTTGATACATACAGGCCGCCGTCTATGTCTCGAAGCCGTTCCAGATCCCCCGA
TGATGGCCACCGCCGATACCGCAGTCGGTCTGCCCACTCTAGCCGGTCGCGATCACAGTCTCCGCCTCAGCGGTACCGTC
AAGGCGGGTGGAACAGACGGCAAGGACAAGGAAGAGGCGGCTTTGGCGGACGGGGCAGAAATGGGGGTGGCAGTGCCGGC
TTCCGGGACTCTCGTCCAGGCGCTGGAGGTGATTATGGCGGCTTTAATGGCCGAAGGAGCTATGAAAACGAGGCCCCACG
GGGTCGTGGCCGAGATGGCTACGGACAGCGGAATCGGTCAATATCACGCAGCAGGAGCAGGAGCTGATGTGGGAAAGTGT
AATATGGTACGATATATTATGGAAAGGCCAATGACCAGCCACTCAAAGTGCCGCAATAGGCAGAAAAGGAGCGTGTCGTG
TTCTCTATCGGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62