GenePrediction:GLEAN_3061 Details

Name: GLEAN_3061
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:521129..522672 (+ strand)
Length: 1544
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:521129..521661 (+ strand)
Length: 533
Type: CDS
Source: GLEAN
Position: GCSC_160:521730..522672 (+ strand)
Length: 943
>GLEAN_3061 class=GenePrediction position=GCSC_160:521129..522672 (+ strand)
ATGGAGCAAACCAGTAACGCCCCACGTGATCATGGCCGATCTGCGACAGGCCCATCAGCACCAGCATCACTGCATCCCTC
CACCCAGGCGCCAGCCTCGCTCAGCGACTCTGTCGACAGCCCTGGGCAAAGCCCATTCAACGATGGCAACGATTACAGAT
CCGCTGTTGCTAGCCATGGCGCCACTCTCGACCCGTTCGCCACCCCAGGTGTTTCTCGGCCTGGGTCATCCGGCGGCACC
AGTGCGCTCGATGCTCATTTGGATGAGCAGTCCCATCGCTACTTTTACAGCCGCCGCATCCAGAAGGGCGACATCGAGAA
GCCGTGGCTGGGGAAAAAAGTGCCCAGGGAGAAATGGGTGACCTATCTGCCACTCATCGGCATCGCCGTCGGACTGGCCC
TCTCGGGTATTCTCATCTGGGACGGCCTCAAGAGTGTGGTCAAGCACAAGTACTGCATGGTGCTCGTCGACGATTTCACG
CAAGGCTTTCGAAAGGACATCTGGACCAAAGAGGTCCAGGTGGGTGGATTTGGGTAGGCTTCTATATGCCACGCTCTTCT
CGTGCTTCTGCATCACTGACTAATACGTGTCACGCGTGCAGCAACGGCGAGTTTGAAGAGACAACGGCGGACGACGAGAA
TGTTTTCGTCCGTGACGGCAATCTTTGGATCATGCCCACTCTCCAAGATGCGACTCTCATGGAGAAGGACACTCTCATCG
ATCTCCTGGCAAACGGCTCTTGCACATCCACTGTGTTCAAGGACTGTGTCGCCGCCACCAACACGACCGCCGGCAACAGC
AGCGTCGTGCCGCCCACGCGGTCCGGACGGATCACCACTAAGGGCAGCGTCTCCATCAAGTACGGTCGCGTTGAAGTGAC
TGCTAAGTTGCCTGCGGGCGACTGGCTGTGGCCTGCTATCTGGATGATGCCCGTCAAGGACACGTACGGGACCTGGCCGG
CGTCCGGCGAGATGGACATCATGGAGTCTCGCGGCAACAACCACACGTATACTCTTGGCGGCAACAACGTCATGGCATCG
ACGCTGCATTGGGGCCCCTCGGTGGCTGACGATGCTTGGTGGCGCACTAATGTCAAGCACTCGGCGCACCATACGACATT
TTCGGAAGGCTTCAACACATTTGGCATCGAGTGGTCAGAAAAGTACATTTTTACCTATGTCAACTCTCGCCTGCTGCAGG
TGCTGTATACCAACTTCGAGACGCCGTTGTGGGAGCGTGGAAACTTCGCCGCACAGTCAACATCGGAAACCTACACCGAA
GTGGACACTGTATGGGCAGAGACCGGCCGGAAAAATACGCCTTTCGACCAAAAGTTTTACTTGATTCTCAACGTTGCAGT
GGGAGGTACCAATGGATGGTTCAAAGATAACAAGGATGGTAAGCCGTGGTTGGACGCCAGCACGAATGCGCCGAAGGACT
TTTGGAATGCCCGCTCCAAATGGTATCCCACCTGGAAACAACCCCAGATGGAGGTTAGCAAAGTCGAGATGTGGCAACAG
TGTGACGGGAGCGAAGATCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62