GenePrediction:GLEAN_3062 Details

Name: GLEAN_3062
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:525504..528326 (+ strand)
Length: 2823
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:525504..525959 (+ strand)
Length: 456
Type: CDS
Source: GLEAN
Position: GCSC_160:526025..528070 (+ strand)
Length: 2046
Type: CDS
Source: GLEAN
Position: GCSC_160:528138..528326 (+ strand)
Length: 189
>GLEAN_3062 class=GenePrediction position=GCSC_160:525504..528326 (+ strand)
ATGGGGCTACCTGATTTCTACAAGATCAGGAAGGGGTCGAAGAAGGCAGCACAGGACGAAACAGAGCTGCCGCCGAGCAC
GAGAAGTGCCGTGCCGCCCATCACTTCAGAGAAGGTTCCGACTCGGCCCGTGAGACAAGGACATGATCAGACTTTGTACG
GCCTGTCGGCTGCACCACCTACACCGTCTGGACCAAGTTCCAGGCCCATGTCATTGTCGGCGCAGTCTCGGGTCAGCTCA
TATCGAACCAACAGCTCCGTCTTTTTAGACGAGATCAAGCATGAGGTCATGGTGAACTATCTGTATCAGCAGCAATGCTC
CCGCCTTTGGGTTTCCGACGGCAGCGGTGAGATCGAGGGTGTTTTGCTTCGCAAGACTCGGGGACAGTATATGGCATGTC
CACCACAGTTGGTGGATTCGCCTTTTGCTGTTGCTTGTGCCGCACTCAATATTCGCGTATGCCTATCACATATCGCCTCA
AGGCGCCCCGTTTCAAAACCTCTGTTGACTGATTGATATAGTGTGCCATGACCGTCAACTCGAGAGTCATCAAGACGTTT
CTCCAATGGACGCCTAACGCCGTTGATGTGCCGCTGTTAAACGGACTCCGCATCCAGATCCTCCCTACAGTGGAAGATTT
GGCACGGGCCCGGAAGCACCAGTTTGCTGCCTTCATCGCCTCGGAAGGACTGCTGGTCGTGTGGGACGACGATGCGATGC
ATATCGTGAGCAGGGCCAAGGACATTGAGACCGAGCTCATGGGCCTGGTGTGGCGGTCAGGCAGCAACGATGACGAGGAC
GAGAAGGGAGGCTTGGTGACGGACTACGAGATCGACGAAGAGAGCGGCGAAGTGAAAGCGGAGAAGCGGCCCATCCATCT
GATGAACACATGGCTGGTCACATTCACCATCATCCTCGTCACCCTCTCTCTCGGCGCAGCGTGGCGCCAGCTGGCTATTG
AGGTTTCCGTTGACAACAATTACATACGGCTTGCCCTGGTCGCCCTGTTTCCCATCCAAATCTTCTTCACGCTCTTCTTC
GCACAGGTCATCATCGGCTGTCTGGCCCAGATCTTCGGCCCCATCCGGCAGCTTACCGTCAACTCCAAGTTCTACTCCGC
CCAGCGGCCACATCGGCTGCAGTCATCCATGCTTCCACATGTCACGGTTCAGTGCCCGGTGTACAAGGAGGGTCTCGCTG
CTGTCATCGAGCCGACGGTCAAGTCGATCAAGCAGGCAATATCAACCTACGAACTGCAGGGTGGCTCCGCCAACATGTTT
GTCAATGACGACGGCCTGCAACTTCTCTCGGACGAAGATCGGCGGGCGCGCATCGACTTCTACGCCGACCATAACATCGG
CTGGGTCGCGCGGCCAAAGGACGGCGAAGCTGGATTCAAGCGTCGCGGCAAGTTCAAAAAAGCCTCGAATATGAACTTTG
CACTCATGATCTCTTGCAAGGTGGAGGAAAAGCTCAGTCTGTACAACCGTGGCCATGACTGGACCCAGAACGACGAAGCT
CAGGCTTACGAGCAGGCGCTTAAGGAGGTGCTCGAGGAAGATGGCCGCGCCTGGGCGGATGGCAACGTCCGCATCGGTGA
CTACATCCTGCTGATTGATTCCGACACGCGTGTGCCGTCCGACTGTCTTCTGGATGCTGTTTCGGAAATGGAGCAGTCGC
CTGATGTCGGTATCATGCAGTTTTCGTCCGGCGTCATGCAGGTTGTCCACAACTACTTTGAAAACGGCATCACCTTCTTT
ACCAATCTCATCTACACGGCCATTCGATACACGGTTTCCAACGGCGATGTCGCCCCCTTTGTTGGACACAATGCTGTCCT
GCGATGGGCCGCCATCCAGCAGGTGTCATATGTTGACGAAGACGGCTACGAAAAGTTCTGGTCCGAGAGCCATGTGTCTG
AGGATTTCGACATGTCTCTACGTCTGCAGTGCGACGGCTATATCATCCGCCTGGCTGCCTGGGCTGGAGATGGCTTCAAA
GAGGGCGTCTCGCTCACCGTGTACGATGAGCTCGCTCGCTGGGAAAAATACGCTTACGGCTGCAACGAGCTGCTCTTCAA
TCCGATTCGCAAATGGATCTGGAAGGGCCCGTTCACCCCTCTCTTCCGTAGGTTCCTGGGGTCTAACATCCGGTTCACAT
CTAAAGTCACCATCATCTCGTACATCGGCACGTATTACGCGATCGGTGCAGCGTGGGTCATGACGACGATCAACTACTTC
CTCATGGGGTGGTTCAACGGATACCTGGACAAATACTACGTCGACTCGTGGCAGGTTTGGTTCTCCATCATCATTGTGTT
CAACGGCCTGGGCAACATCTCCCTCGCAATCATGCGGTATCGCGTCGGCGAGCGGAGTCTCCTTTACTCTCTGTACGAAA
ACTTCAAGTGGACCCTTCTCCTTGCCATCTTCCTTGGCGGCCTGTCCTTGCACGTCTCTCAGGCCTTGCTGTCACACATG
TTTGAGATAAACATGACCTGGGGTGCCACATCGAAAGAGGTCGAGTTCTCTAATTTCTTTATCGAGATCCCACGAGTGCT
GAAGAGGGTATGTACCCCTTTCTGAAAACTTTCCGCTACCTGTTTGATCATGATCAGCCTACTAACTGCCACAGTTCAAA
TTTTCAATCCTGTTTTCATTGGTGTCCATTGTCGCCATGATTATCCTGGCCGAGGCATCCTTCGTGCCATACGACTGGAG
GATCAAAGACTTTGTTGCCATATTGCCTATGGCAACTGTTTCCGCATCGCATCTGTTGTTGCCATTCGCCCTCAATCCCG
CGTTGATGACATTCTCTTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62