GenePrediction:GLEAN_3063 Details

Name: GLEAN_3063
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:539550..543201 (+ strand)
Length: 3652
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:539550..539988 (+ strand)
Length: 439
Type: CDS
Source: GLEAN
Position: GCSC_160:540069..540576 (+ strand)
Length: 508
Type: CDS
Source: GLEAN
Position: GCSC_160:540648..541070 (+ strand)
Length: 423
Type: CDS
Source: GLEAN
Position: GCSC_160:542093..542328 (+ strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_160:542402..543201 (+ strand)
Length: 800
>GLEAN_3063 class=GenePrediction position=GCSC_160:539550..543201 (+ strand)
ATGGCCGAGGAATCATCCAACGACGGTTCCATCACGGCGGAGAAGCTGCCCCAAATCCTCAGCAGCGATGTCAAGGTCAA
GGTGGCCGGCGTGGACGTCGACGGCATGCTGCGGGGCAAGCTCATGTCCAAGAAGAAGTTCCTCTCGATCGTCAGCAGCG
GCTTCGGCTTCTGCTCCGTCATCTTTGGCTGGGACATGCACGACATGACGTATTTCCGCGAGCTCCGGATCAGCAACAAG
GAGAACGGGTACCGGGATATCCTGGCCGTCCCAGACCTGCAGACGTTCCGCCGCATCCCGTGGGAGGACAACGTGCCGTT
CTTTCTGCTTCGCTTCTTCGACCCGGACACAATGGCGCCATTGAGCGTCTGCTCACGCGGCCTGCTCACCAGCCAGCTCG
ACAAGCTCAAAGAACGGGGTTTCGGCGCCATGGCCGGAGGTAGGCACAGTCCCGGGTCACCAGCCGTCTCTGCTGGCAGC
GCATCCTTTTGTCTTGCAGTTCTTCGCTAAGCCGCACAGTCGAATACGAGTTCTTCAACTTCCTGACGCCATCCGACACT
CCGGGCGCAGACAGGAAGCCATCCACAGCCACGTACCTGGCCAACAACCCGGTGCAGTCCCTGCCACCACTGACACAAGG
CATGTTCGGCTACAGTCTGACGCGACCGGTGGTCAACAAAGACTTTTACTACGACATCTTCGAGACGTGCAACAAGTTCA
AGTGTGACATCGAGGGCTGGCACACGGAGAGCGGCCCAGGCGTGTACGAGGCGGCGCTGGAGTTTGGCAAGATTCAGGAA
ATGGCCGACCGGTCAAGCCTGTTCAAGTTTGCCGTCAAGTCGGTGGCTGTCAAGTACGGCATCACGCCATGCTTCATGGC
CAAGCCGCGCCAAGGTCTTCCGGGCAACAGCGGCCACGTGCACATTTCCCTGGTGGATGAGAAGACGGGCAAGAACCTGC
TGGCTCGGGACACACCTGACGCTGATGCGCCATGGTCCGACATTGCGCATTTGTCCGAGATGGGACGGTATTTCCTGGCC
GGTATCCTCGAGGGATTGCCGGACATCATGCCGCTGCTAGCACCCCAAAAATCAACAGCTACAAGCGCCTGGTCGAGAAC
TTCTGGGCCCCCGTTACCGTGTCCTGGGGGCTGGAGCACCGGCAAGCGTCTGTCCGGCTGATCTCGCCACCCACGTCCAA
GCCGGGCGCCACGCGCTTCGAGGTGCGCGTGGCTGGTGCCGACGCGAACCCGCACTTTGTTCTTGCTGCCATCCTCGCTC
TGGGCTGGCGCGGCGTCGAGAAGAAGCTGCCGATACCGTGCCCGCCCCTGGGCAAGCAAGACGGCGCAGGCACGACGAAC
GACGGTGGCGAGCGGTTGGCCCGCAGTCTGCGGGAGGCCACCAACCGCTTCATGGCCCCGACAAGCATTGCCCGGGAGGT
GTTTGGCAACGAGTTTGTCGACCACTTTGGCGGAACGAGAGAACACGAAATCCGCCAATGGGACGAAGCCGTGACAGACT
GGTAAGCTTTCCCCCTTTCCACTGTAAGACGCGCTGATGCTAATCCGGGAATTTAATTCTCAGGGAGGTAAAGCGTTATA
TCGAGACGGTTTAGAGGGGAATGCCGGGAACGAGCAATGTTTAAAAGACTGGACCGGTGACAACAACGGCCAGCAGATTG
GAGACAAATGCATGGAGAAATAGACATTGCATACACAGTTATTTTGCCAAGATTTCTGCTAGAGACGTTCAGCTGGGCTT
GTTTTCCACCGCAAAAGGATTGCCACGTCATTCGGAAGTCTCGTCGGTGAAGCATGGCACGAGCTGCAGACGCGTGCAAC
ATCAGTGCCACCGGTGGAGGCGTAGCGAAGACAGAGCGGAACATTTCCGCGGCAGCGTTGCCCAAACAGGCCTGGCAATT
GTTGTCAATTGTCATCGGCATTCCTCTCGTTGGCCCCCATTTTCTTTCAAACTCGCCCATGGTTCTTCAAGTGCATATGC
ATGTGTCGAAACGAGACCTCGCTCGAAGCAGATTCGATTTCATTCCACTCGGATGTTTGTTCTTCGCAACTGCATTCGTG
CTCAGTAATGTTGAGTGCCAAGGGAGTGTGAACTATTACCAGCTTCCACACATCTGCGGCTTATTTCCGCCACAAATAGG
CGCCTCCTGGCTTATCATTCTCCGAATACGGTGAGCAAGATGCTTCCTGTTCCGCTGTCCTTGCCATTTGAAGAGCCGGG
CGGGTGGCTGCTGACATGGTTTCACTACTATATTAGCCTCTTCTCCTCATGGCTGGCTGGTGGTTGCTCTATGGCTGTGC
CATCCCTTCCTCGGCCGGAGATGTGTCCGGAAGCTAGAGGCGTTCTTGATCGGTACTTTTCAAGGCAGCCGCGCTTCCTC
GTAGAATGTTGCGTCTTTGTTGCATCGGTCTCTTTGTCTTCCCTCTTGGTCCTCTTCTACGTCGTATGTGTCTCTCCAAA
AGCTGAGAGCAATTGTGGGTTCGAAATTACACTACCACTAACACACGAGAACATGGCGGCAAGCATAAAACAAGTCTGCC
CGGTATCGCATCCAGCAGGAGCCCTAGAAGGGCGGCATGAGACGGAGGTAACAGCGGACGGGAAGCGGGAAGTGCTGTAT
CCGTTTGCCTTCAAGAGCCTTGACTGGGACGTCTACCACCAGTTCCGGCCCGTCTATCCCGCGTCTCTCTTCTCGATGTG
GCTGGCGCATCACAAGAGTCACGGTGGCAGCCTTAACACGGCCCACGATCTCGGATCGGGTATGTAGCACCTCATAGTTT
GGGCTGAGGATCAGAGAGATGCTGAGTAACGTCATTTTTTCTGCTGCAACAGGTCCTGGGACTGCAGCCGCGGTGATCGC
CCACCACTTCGCCAAGGTGGTCGTGTCCGATGCCGGTGCGGCCAACCTGGCGACGGCCAGAGCCAACCTGGTGCCGTCCG
AGCGCTTTGCCTTCCACCAAGGTCCCGCCGAGCAGGCCAGCGCCTGGCTGCCTCCCCGATCAGTGGACCTGTCGTCCGTC
TGCATGGCCTTTCACTATATGGACGGCGAGGCCACCGTCCGCTCGGTCGCGGCAACGCTGAAGCCCGGTGGCAGCCTGGT
TGCCGTGACGTACGGCTTCCGCCTGCTGTTCCCGGGAAACCCGCGTGCCGAGACGCTGTGGTACGGCGCCGCGAGCCGCG
AGACGCTGCGGCTCCTACGTGAAGGCCGGATCTTCCCGGCTGCTGTACAGGGCCTGGCCAAGTCCATGACCGGCCTCGAC
TTTGTGCCCTTGCCGGGGGACCTGTTTGAACCAGGTGCTCGCCGGGTCTACATCAATGTATCGCCAGACGAGCCGCGGCC
GTTCTGCTTTGTCGATCCGGACGCGGCCCTGTGGCAAGAGGCACCAAGCCAGGTGGCGCCTGAGGATGCGCGCGAGTACA
TGTGCGACCGATCGTGGGGCCGCCAGGCGGACACGGCCTGGCTTCGCGGCTTCTTGGCGAGCTGCCATCTGGGCTTTGAC
GACACTACCTGGGCTGTGGACGAATGGCAGGAGCTGGAGGCGATTGTCCATGCGCAGCCCAACGGCACGATCGCGATCGA
GTGGCCCGTGTCTGTGATTCTGGCGACACGGAAGATGGAAGGGGAATCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62