GenePrediction:GLEAN_3064 Details

Name: GLEAN_3064
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:547258..549639 (+ strand)
Length: 2382
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:547258..547330 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_160:547405..548116 (+ strand)
Length: 712
Type: CDS
Source: GLEAN
Position: GCSC_160:548175..548754 (+ strand)
Length: 580
Type: CDS
Source: GLEAN
Position: GCSC_160:548831..549016 (+ strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_160:549075..549262 (+ strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_160:549324..549639 (+ strand)
Length: 316
>GLEAN_3064 class=GenePrediction position=GCSC_160:547258..549639 (+ strand)
ATGGTGGTTCCTTCTCTGGACCAGGGCGTCGGCTATGGCGTCGTGCTGGGCCTTGGCATAGCCTTTGCGCTGGGTATGTT
CTCGTCTTGCCATTGTGCGTGATTCCATCGTGTCTCGGAGGCTGATACGTGCGTCTCGATGGGACAGGCATGATTCTCGT
GACGTTCATCCTGCGTCGCTACAACTCGGAGCTGCAGACGTCCGAGATGTTCACCACGGCGGGCCGCACGGTCAAGTCCG
GTCTCGTCGGCTCCGCCGTCGTCTCCTCATGGACCTGGGCGGCAACGCTGCTGCAGAGCACGGCCGTCTGCTATCGCTAC
GGCGTCTCGGGTCCGTTCTGGTATGCCTCCGGCGCCACCGTGCAGATCCTCCTCTTCGCGACCCTCGCCATCGAGCTCAA
GCGCCGCGCGCCCAACGCTCACACCTTCCTCGAGATCATCCGCGCTCGCTACGGCTCCATCGCCCACATGGTCTTTCTCG
TCTTCGGCCTCGCCACAAACATTCTCGTCTCTCTCATGCTCATCATCGGCGGCTCGGCCACCATCAATGCTCTCACCGGC
ATGCACACCATCGCGGCCATCTACCTGTTGCCCGTCGGCGTCGTGGCCTACACCCTGGTCGGTGGCCTCAAGGCTACCAT
TTTGACTGACTGGGTCCACACCGTCATCCTTCTCATCATCATCATCGTCTTTGCCCTCACGACCTATGCCTCGTCCGACA
TGCTGGGCTCGCCGTCAAAGGTCTATGACCTCCTTGTCGAGGCTGCCGCCTCCCACCCTGTCTCCGGCAACAAGGACGGC
AGCTACCTCACCATGCGGTCCCGCGAGGGAGGCATCTTCTTCGTGATCAACATCGCTGGGTATGCTTAGTCATCTTAGAT
CGACTTTCGACTTTGTACGTGCTGACATCTGCCATAGAAACTTTGCTACAGTCTTCAATGACAACGGATACTGGAACAAG
GCCATTGCTGCCTCTCCGGTCCATGCGTTGCCTGGTTACCTCATCGGCGGCCTCAGTTGGTTTGCCATCCCCTGGCTGGC
CGCAACAACGATGGGTCTTGCGGCTCTTGCGCTGGAGTCGAACCCGAACTTCCCCACGTTCCCTCTGCGCATGTCGGAGG
CCGAGGTGTCTAGCGGTCTGGTTCTTCCCTACGCCGCCGTCGCTCTTCTAGGCAAGGGCGGCGCGGCGGCAACTCTGCTC
ATCGTCTTCATGGCCGTGACGTCGGCTACCTCGTCTGAGCTCATTGCCGTCTCGTCCATCTGCACATACGATCTGTACCG
GACGTACATCAACCCCGCTGCGAGCGGCCGCAGTCTTGTTTGGATGAGCCACTGCATCGTCTGCGCGTACGCACTCTTTA
TCGCCAGCTTCTCTGTTGGCCTTTGGTATGCGGGCATCAGCATGGGCTATCTGTACCTCATGATGGGCGTCGTGGTCTCT
TCGGCCGTCCTGCCCCTCACCTTGACCCTCACCTGGTCGGGCCAGAACAAATGGGCTGTGAGTTCTACTTGAATTCAGAA
TTTCTATATCGGGTACTTACACCGTATTGCATCTGCTGACTAATACGTCTTAGGCTTCTCTGACCCCGATTTTCGGGCTG
GCTTTTGCCTTGATAGCATGGCTTGTCACTGCCAAGCAAGAGTGCGGGTCTCTTGATGTGGACTGCACCGGCTCAAACAA
CCCCATGCTTGCAGGCAACGTCGTTGCTCTGCTTTCGCCCTTGATTTTGGTGCCCATTTTCACTCTGATTTTCGGAGTCG
TAAGTGCCCCACCAATTGACTACTTGTCAGATCTTGTGCTGATGCGTACATTTACAGGACCATTATGACTGGCAGTCTAT
GCTCGCGATTCGCAGAGGCGACGACCACGATCTTGCTGCATCGGCTGGTGTCGACTTGGAGAACACGCTGGGAGGTCAAG
AAGAAACCGACACGGAATTTGCGCAAGAGCTGGTGAAACTGCGACGGGCTAGCAAAATTAGCAGGTGTTCCACCGCATTC
TTGACGTACGTATCTCGAAGTTGGAAAACCTTTGATTGTTTGGCCTCTGACTAATTCATGTCACAGTATCGCCTTCCTCG
TTCTCTGGCCTATGCCCATGTATGGCTCCGGCTACATCTTCTCAAAGCCCTTCTTTACCGGCTGGGTGACGGTCGGCATT
ATCTGGATTTTCTGCTCCCTGGCTGCGGTGGGCATCTTCCCTGTCTTTGAAGGACGGCGCACACTGGCCTACACCTTCAA
GTGCATCGCTTTGGACCTCACCGGAAAGGGCCGGGGAAAAGCAATTCAGGCCGAACGCGAAACTGCTGCTGTTGCTGTTA
CGGGCGACGTCACGCCTACAGAGAAAAAGGATTCTTCCAAGGAAGAGACTGTTGTGATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62