GenePrediction:GLEAN_3065 Details

Name: GLEAN_3065
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:553622..554573 (+ strand)
Length: 952
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:553622..554006 (+ strand)
Length: 385
Type: CDS
Source: GLEAN
Position: GCSC_160:554111..554267 (+ strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_160:554345..554573 (+ strand)
Length: 229
>GLEAN_3065 class=GenePrediction position=GCSC_160:553622..554573 (+ strand)
ATGACTTCCACCGGCGGCCGCAGGATGCCCGTGTTCTTTCTTGGTATTGGCGGGCCAGGATTTACAGACAATGCTTCCCA
CCCAGCAAACGTCAAGCTAGAAGAGATTGGGAAAGACATCACCACTAAAATCAAGCCGAAAGCAGTGGTTGTATTCTCTG
CGCATTGGCAGGAATCTCCGGGGATCAAGATTAACGCAGCCGAGCACACGGATCTGATTTACGACTTTTACGGGTTTCCA
CCTGAATACTACCAAATTGACTATCCCAACAAGGGAAGTCCTGAGATTGCTGAAAAAGTTGTCCAGAAACTGAATGCTGC
TGGGATGAGGGTCGAAAAAACTAAAAGAGGTTTGGACCATGGCATATGGGTTGGCTTCATGGCCGGTATGTATGCCAAAC
CAAGTTTTACACTTTATTGGTTTTTAACAGGTTTCAATCCACAGCTTTTCATCCGACGAAAAACCCACTAAATGTGCCCA
TTGTACAAGTGTCACTCCTCGCCAATGACGACGTGGAACAGCACTATCGTATAGGCGAAGCACTGGAAAGTCTTCGTGAC
GAAGGCATCATGATAATAGGCGCTGGGATGGCAGTTCATAACTTGTACGACTTCCGATCAACAATAGGAACTGGGAGAAA
CATGCCGTAAGCAACCTCGTCAACGCCCGAAAATGTCCGCCGTCTCAGTTTTGTCTGACAACTCTCCGTAGATATTGTAC
TAGCTTTGACGAAGCCTTGAAGGAGGCTGCGACAGCAAGCCCAGAAGATCGACGGGAAGCTATGGTGGCTTTGATGAAGC
GTACTGATGCAAGGAAAGCACACCCTAGTGTGGAACATCTACTGCCCGTCTTTGTCGCTGCCGGTGCAGCTGGCAAGGAT
AGGGGAATGCAACGCTGGACGCTTCCTGAAGGAAGTTTGAGCTGGGCGCAGTATCAGTTTGGTGGGATTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62