GenePrediction:GLEAN_3066 Details

Name: GLEAN_3066
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:555465..556826 (+ strand)
Length: 1362
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:555465..555718 (+ strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_160:555773..556826 (+ strand)
Length: 1054
>GLEAN_3066 class=GenePrediction position=GCSC_160:555465..556826 (+ strand)
ATGCTCGTCACTACCATGGCGCAATACACTGTGCACACGTCTTGGCTGTTTGACCCCAAGATCAAGCAGGTGCGGCACAA
TGTGTCTGTCACAGTGGACGTGGAGAGCGGTCTGATGGTGCGGGTGTTTGAGCGGGACGACGAGGCCGTCCCGTTCTCAG
AGACATGCAATGCCAGCGATGTCGATCTTCGCGGCAAGTTTGTGCTGCCAGGACTGGTGGATGCACACACGCACGTGTTC
CTACACGCATACGAGTAAGACGGCAGCCCGAGCAGAATTGGCCGCATGGACCTGCTAATGGACTGCAGCGAGGCCGGGGC
GCTGAAGCAGAAGCGCGACGAGAGCATGACGGAGAGGGTCGTCCGCGGCGTCAACCACTGCCGAACGGCACTTCTGGCCG
GCTATACGACGTATCGCGATCTCGGCTCGGAGGGCATGCAAGAATGTGACGCCAATCTGCGGGACGCCATCGCACGGGGA
CTGACACCGGGGCCACGGCTGTTTGTAGCGACCAAGGTGCTAGCCAGCACAGGTTCGTTTGAGTGCCGGACGGAGAACAG
CGGCAACGGCCACTGTCTGCCGTCAAGCGCAGACGCCGTGGACGGTCCGGAGCAGTGCCGCCAGGCTGTACGACGACGCA
TTGCCGCCGGTGCCGACATCATCAAGTTCTTTGCCGACTACCGGCGTCGGATCATGCGCTGTCCTCCGGCCCAGCAGCAC
CCGTACATTGTGGGCGTGCTGCACCCACCCGAGGAGCCGAACCCGGACTACATGGTCTTCTCGGCCGAGGAGATGCGCAT
GATCGTGGCCGAGGCACAGCTGGCCCGCTGTCCGGTCTCAGCGCACTGCTGCACGCTCGAGGGCGCGCTGGCGGCCATCG
AAGCCGGCGTCGACTCCATCGAGCACGCCTACTTTGCCACCGACGACATGTATCGGCGCATGGCCGACAAGGGCGTCATT
CTGGTGCCGACGCTGGCCGTCGCCGAGAAGCTGCACGCAAAGCGCTTCCACGAGATCCTGCCGCAGGTCAAGCGCGCCTT
TGACCTGGGCGTGCGTGTGGCCTGCGGCGGCGACACTGGGACGTATGCCCACGGCGACAACGTGCGCGAGCTGGAGCTCA
TGCTCGAGGCCGGCGTCGCCTTTGCCGACGTGCTCGAGGCCTGCACCATCGGCGGCTGGGAGGCCTGTGGCGGCAACCGG
TGCGGCCGCCGGTTCGGCTGGTTCGACGCCGGACTACAGGCCGACATCATTGCCGTCGACGAAAATCCGGAAACTACAGC
CGGCGCACTTCGCAATGTCAGCTTCGTCATGAAGGACGCAAAGGTCTGGAAGGCCGATGGACAGGCAAAGTTTGCGTATT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62