GenePrediction:GLEAN_3067 Details

Name: GLEAN_3067
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:557116..558181 (+ strand)
Length: 1066
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:557116..557188 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_160:557260..557413 (+ strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_160:557472..557887 (+ strand)
Length: 416
Type: CDS
Source: GLEAN
Position: GCSC_160:557943..558181 (+ strand)
Length: 239
>GLEAN_3067 class=GenePrediction position=GCSC_160:557116..558181 (+ strand)
ATGGCAGCAAGAAACCTTCTCTCGGGCGAGCTCTTTGACGTCGCTGGACGCACAGTCACCATTACTGGTGGAGGTAAGAG
CAGCCGACAGATATGAACAAGACAATACATGGGAGAAAGCCAAGAAACTTACACCATGAGTCAGCCAGTGGCATTGGTCG
CATGCTGGCCCGTGGCTTCACGGCTAACGGAGCAAAGACCATACTGGTGGACGTGAACGGAAAGGCGCTAGAGGAAGCCA
AAGCAGAGCTGCAAGAGCTGTGCTCTTCGTCCGGCCTGGCACCGGCCGACACCATCACGTACGTTGTTCCCTCTGCCCAT
CTGTCCCGTTGGTGCACGATGCTGACCCGCAGACAGTATCCACGGCGACCTAGCAACCGAGGAAGGAGTTCAGCAGGTGG
TTGACCGCATCAAGGCGACTGGGAGCTCGCTCGACGCACTGATCCATTGTGCCGCCATCCGGTACATGAACGAGATCACC
TACAGCCCGGGTGAGGGCCTCGACAAGCTGGAGGCGGCCACGCTGTCGGCACCGTACAAGGGCTGGGAGCACACCTTCCG
CGTCAACGTGCTGGCACCCTACTACCTCACGGCTGGTCTGGTCGGCCTCCTCGGCGCAGCTGCTGCCAAGGGAGACGGCC
GTGGCTGTGTCATCATGTTCTCGAGCCCGGCCAGCGTGCACAACAACCAGTTTGTGCCGTGCTACCAGACATCCAAGGCG
GCAGTCGATCACCTGGTCCGTATCATGGCCATGGAGTTTGCTGAATATTACAGTACGTCAAGACAACAGACATTCGATCG
AGCGCGTGACATGCTGACCAACTTCAGTTCGCGTGAACGCCATCTCGCCAGGTATCGTCCCGTCGGGCATGACGACCACC
GACGCAAATTCGAACCTTCATCTGGCAGGCGAGACGCCGGCAAAAAGGGCCGGCACCGAAGAGGACATGGTCGGCACGGC
GCTGTGGCTGACCAGTAAAGCGGGCGCTTTCATGGACGGAAAGGTCGTCCGTGTTGAGGGAGGACGGCTGCTCATCCTCA
AGGGCGTGACTTCCAATTCCGATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62