GenePrediction:GLEAN_3068 Details

Name: GLEAN_3068
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:559664..560384 (+ strand)
Length: 721
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:559664..559709 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_160:559966..560384 (+ strand)
Length: 419
>GLEAN_3068 class=GenePrediction position=GCSC_160:559664..560384 (+ strand)
ATGATTTACGGCATCGAGCCCCTGTCTTCATTTGGGCACGAGCCATGTTGCTCGCACATCCACATCTGCATTTGCTTGCA
AGTCTTTAGCTCTTCCTTCTCTTCATTAGCAGCCATTGAAGGCGGAGACCCCCACTCTTCCTTGGACAGGATTCATGATA
AATTGTGAGCCTCGTCTTTCCCAATAGTTACGACATTGCGCCGTGACGATCACACCTTCAGCAAAAAGACAACAGCCACA
ACCATTGACAAGTACGTGTCGTTATGCATGCAACGGACCAATTAGAGACTGACTGGTCGTAGTGACGGCAACCGCAACTG
AACAAATCACGGCCACGCTCCACGCCTATGGGGCGGCTCTGAAAAGTCGCAACGTGGGGGAAGCAGTCTCGCTCTACACC
AGCGATGGTGTGATCCTGGCACCGCACTTCCCAGCAAGCGTGGGTGCACAGGCCCTGCACGACTCGTACACGCGGATCTT
CTCCAGCGTTCAGCTCAATATCTCGTTCCATATCGAGGAAATTGTGGTGCAGTCGGACGAATGGGCGTTCGCACGGACCA
CCGCCGAGGGTTCCAAGACGATGCTGAAGACGCAGGAAACAGAGTCACACTCCAACCAGGAGCTCTTCCTCATGAAGGTA
GAGGGTGGACAGTGGAAGATTGCAAGATACGCATTCTCGAGCATGAAGCCACTGGTGCAAAACGGGGTCCGGAGAAGCTA
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62