GenePrediction:GLEAN_306 Details

Name: GLEAN_306
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:928060..928566 (+ strand)
Length: 507
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:928060..928566 (+ strand)
Length: 507
>GLEAN_306 class=GenePrediction position=GCSC_167:928060..928566 (+ strand)
ATGGGCCTCAACGATCTCGTCACCCTCGCCCGCGAGCGCTTCAGCACCAACGTCTCGGCCTCCATCAGCAACCTGTCAGC
CCAGCAGTGGATCCGCCTGATCGCCATCGCCGGTGCCTACATGCTGCTCCGGCCGTACCTCATGAAGATTGGCGGCAAGA
TGCAGATGCGCCAGCTCGAGGCCGAGCACGACGCTGCCGAGCAGGAGGCCCTCGCCCTGGCGGCCAAGAAGCGCCCAGCC
CTCTCGCCCAACGACCTGCGTGGCACGGCTGCCCCCGGCTCCATGACCGGCCTGCTCGGCCTCGACGGCGACAGCGACAG
CGACGATGACAACGACGACGACAACAACAACGCTCCCGCCACCAGCAGCGGCGCCGACTGGGGCAAGAACGCCCGGAGGC
GCCAGCGCAAGATGGTCCGCCAGCTTCTCAGCGCTCACGAGAAGCAGCTCGCCGAAGCCCAGGCTGACGAGGAGGACAAG
GACATTGCCGAGTTCCTCCAGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62