GenePrediction:GLEAN_3070 Details

Name: GLEAN_3070
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:563221..565146 (+ strand)
Length: 1926
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:563221..563683 (+ strand)
Length: 463
Type: CDS
Source: GLEAN
Position: GCSC_160:563752..564849 (+ strand)
Length: 1098
Type: CDS
Source: GLEAN
Position: GCSC_160:565133..565146 (+ strand)
Length: 14
>GLEAN_3070 class=GenePrediction position=GCSC_160:563221..565146 (+ strand)
ATGCATTCCGCCGTCCCATTTAGGGCCATTGCCCTATTCTCAGGCTTCGTGTCCGCGTATCGAAATCCTTGTCAATATGG
GATAGAAAAATACCTCATAGTCGACTCAAGCAACGGGCCTATCACCGGACATAGAGCAGCCAACGTTTCGTGTGTCGTCG
AATATCTCGGCATTCCATACGTGAAACCCCCTGTAGGAAAGTTGAGGTTCGCAGCTCCAGAGCGGTTTGTCTCCACGGAA
CCTTACGAGGCCGCCGCATTTGGTGACGACTGCCCTCTCAAAGCATCAAAATCAGTTGACTACCCGGACTTCACACCCCA
GGCCCAGAGGATTGTCAACTACTTTGCTTCGGCAGCCGGCACCTCACAGAGCGAGGACTGCCTTACGCTCAATGTCTGGT
CCAAGCCGACAGCTAATGCGAACAAGGCCAAAAAACCGGTCTTTGTCTTTTTTTACGGTGGACGTGAGTCTCCATGGCAA
GATATGCCACATTTCTACGCCCGCATGCTGATGAGGCTCTGATGTCTACAGGCTTCACCATTGGAAACACAGACACGCCT
TTCTACAACGGCCGCTACTTTGCCGAAGCCGAAGACATTGTTGTCGTGACCGTCAACTATCGCCTCAACATCTTCGGCTT
CCCAGGTTATCCAAACGGGACTCAAAATCTCGGCCTTCGCGACCAACGCGCTGCCGTGGAGTGGGTCCGGGACAACATTG
CCGGATTCGGTGGCAATGCCTCTCGGATAACCATTGACGGTCAGTCGTCTGGTGGTGTCAGCGTGGACTACTGGGCCTAT
GCATATCGGGATGACCCTATTGCCCAGGGTATCATCGCACACTCCGGAAATGTCTTCAGCTTCCCTGTTAACACCCAGGC
TGTCCAAGAGGCAAATTGGAACAAGGTCGTGGCAGCAGTCAATTGTTCTAGTGCTGTCGACACTATGGCATGCATACGTG
AGGTGGAATGGCCGGCAATCGAGTCTGCTGCCGCATCCATAAAGCCAGCTTCGAGTACCAGTGTTCTTCGTTCCATCCCG
GCTTTCTGGCCCAAGCCAGACAACGAGCTCGTGTTTTCAGACTACGTTAATTTGACCGTCAAGGGCAGCTTCTCCAAACT
GCCCATCCTCTATGGAAATAACGACAATGAGAATGGCTACTATCAAATTCCGGCTTATGCCCAAGGCATCATTCCCACAA
CCTCTCAGGTCACCACTTTTCTCCTCGAGTCGTTTACTTGTCCCGTTTCGTACCAGGTGACCGCTCGACGGAAGCATGGC
ATCCCCTCATATGCCTACCGCTACTTTGCCAACTGGAATAACACCCGTCTGTACCCGACCTCAGGCGCCTACCACGGCGT
TGATCTGCACATGATCTTTGGCGCTTCCGCCGATGTCAGCGGTCTGCCTACCTCGGCTGACCAGCGTCAGCTCACCACTG
TGATGCAACAAGCATGGTTTGCCTTCTGCAGCGATCCACACCACGGCCTCGCCCGAGTTGGCTGGCCCTTGTTTGATCCC
GGCAGCGAAACCCTCGTTCAGCTGGGTCTGAACAACGTTCCCAAGGCTCTTTTCACAAGCCCCTCTGTCTACGACGCGCC
GTGCTCGACCATTACCATGGGTGCCTTGGGTACGGTTTCAACATCCACGGCGTTTGACTTGGTCAAGACTACAAAAAGCA
GCTTGTCATTTTTGTAATCATGATTCAATTTATGGCTCGGGGTTTGCGTCGAAACAGAAATGAAGTTGGCCAAAAAAGCA
CTTGTTGAACAAACCAAGTTCGTATCTAGCACACCAAAACAGCTATAAGTAGTGTTTTGATTCCTTGCGGAGCACAATTT
CGATTTCGAGGATCACGGCAGTCTATATTCAGCCAATACAATAACATGCCGGCTGCTACACTAATTTCGAAGAGCTCATC
CTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62