GenePrediction:GLEAN_3071 Details

Name: GLEAN_3071
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_160:573884..578398 (+ strand)
Length: 4515
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_160:573884..574201 (+ strand)
Length: 318
Type: CDS
Source: GLEAN
Position: GCSC_160:574255..574410 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_160:574778..575673 (+ strand)
Length: 896
Type: CDS
Source: GLEAN
Position: GCSC_160:575747..575819 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_160:578138..578219 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_160:578274..578398 (+ strand)
Length: 125
>GLEAN_3071 class=GenePrediction position=GCSC_160:573884..578398 (+ strand)
ATGTCCGAACTTCAGACCATTGTCTCCATCTGGCAGCTTATTGCCGAGGTGACCGAGAATGTCGAAGGGCTCAAGAAGCT
CGACAGTGCGTCGCGCAGCCTCGCCAGACGAGTCTCCAACGAGGTCACCATGTATGGCCAGTTCTTTTGCAAGCTCACTC
TAGTTTCAAACTCCTCATCCAGTGACGAATGTCTATGGAAAAACATTGAGGCTCGATTGGGAGACAAGACCGCCCGTCTT
CTCGCATCCAACTTCCAGTCTATGCAAAAGACACTGAGTAAGCTCAAGAACGATATCACGAGTACCAATCTCGAAACTGT
GAGCCATACTCGTCATAGTTCTCGACCAACAGAATTCTGACTCAATTACAGGCAGTTTTGAACAAGCTGGGACCAAGTGT
CGCCGACACTCGGAAGGGTACTGGAACTTCACGGACAACAATCCAGAAGCGCTTGGACAAACTGTCTACAATCAACAAGA
ACTTTGCATCTTATATGGCCAACCCGTGGATACCACTGCCACATCTTGTAAGACACTGCAACCCACCAAACTTTCGATTG
TTCTTTCACCGCGAAAGAAGCCTATCGATGGAAACACTTTACGTCATGAGCGAAGGCTACGCTTGCAGCTGTAAAGGGTT
CCATGTCGCAAGCTACGACTGTCATTGCTCAGCCTGCAACGTTCGGTTCTCGGAGTCTGAGTCTTGGAAAGATGGCTGGA
CCTGCGATTATTTGTTCGCACCAAGATCGTCACTATCACATTCTTTGATGTCCGATTCGAAGATAAAAGCTCGTGAGGCT
GGTATGCCGGTGCAAGGCTACAGGTTAGTGGATATATCAGACACTATTGAACATCGACACGGAAATCGAAGCTGACAATC
TCAGAAACCAGCAGCTAGGTGCAGAACAAAGGAAGACGAAACCGACTCCGAAGCCCAACGTGCGTACACCAGAAACGTCC
ATAGCTGCTTCGAACCCATCGGCCGAAGGAGCGGAGGGAGATATGCATGGCTGCCCACCCACACAGGATCAGACTTCCGT
ATCAGAAATGATTGATACTCGTGAGCTGAAGACCCATCGCCGTCCAGGTACTTCGGAGACGGAAAACAGATCATTTCTTC
AACTTTTGGACGACATAAAGTCGAAGGTGCCTCTAACTTCACTTCAAGACCTGATACGACCCGGTAGGAGAAAACTAACC
CGGGGGAGGCGGTTGGATCTCGCTTTTCGGTTCTGTGCATTCGTTTTGCGGTTATCGACTACTCCGTGGGCCGACGATTT
CCGGGAATGGGTCAATTGGGACATTAATTTCGGCCACTTGGATGGCGAGGCACACTGCGGTCAACATCCTGGCCGAGACT
TTTATTCACTCCAGGTCTCTGTTGACAAATCCACCGATTCGATGTCATCTAAGAAAACCCAGTCTCAGCAGCCAATGCTG
ACTAAGATTGGCATAAGCTTGATAGAGCTAGCCTTCGGCCAGTCTCTCGGAGAGATTCGACAGAGTACCCCAGGACTTCT
CGTTGAGAAAGATTTGCAAGAGAATTTCCAAGCAGTGGACAAGCACCTGCTGGATATTCTTACTGCTAAGCAGCTACTCT
CTTCCCGCCGCATTCGAGATGAAATCGGCGTTGGTTTTGAAGATGCAGTCGGTGCCTGCGTCTATCGACAATTTCAAGAG
TTCCGCAGCCTGGCCATTAAGGAGCTCAACATGGCGCAGGAATCCTTCCTGGAAGATGCAAAATATGCTATTTTGGCACC
ATTGTACCGAGAAATTATCAAATATTCTCAGTAAGTGAGATTGCAGCAGGACCTCCCATCCTTATGTCGCATCTCCGATG
CCCAAGCTAATGACTTTTTGCAGGCACGAGTGCGATGGAAACCACTTTGATACGCTCGGTCCTGGAGATATTACAGGCAA
CCCAGAAATCCGAACGGTACATGAAGTGTGGAACGCTGACGCTCACTCGGATTACGAAGAATCTGTCGATACTAGCAACA
AAACAGAGCGGCGGGACGACTCAATAGCAAACGAAGCCTGTTGTCCTGTTCCAGTAACTGCTTCTGGAAACGAAGCAATC
AACATCGACTGTACTCGGCCCATTCCCTCGAGCTGTGGGCGATCAAATGAACCACCTCCTGCACGTTCTGAAGATTCCGA
TTTCAGCATGAGCTCCGAGAAGCTATCTGCAATGATGCAAAGCTCGAACCGACTAGCAGACAAAGCTCCAGAAGAGCCGG
TCGTCATAGAGCATAGCAGTCGAAGCGCGGTGCATTTGATTCCGAGAGAAACGCAAATTGAGACTAGATATCCCCGTTCG
ATTGATATGGATTCTCTGTGGTCTTTCAATGCCTCAACTGACCTAGACTCGGCCTTCTCACTGACCTCCGATATGTCCGA
CCCACCAGCTCCCTTACCGTCGAATCATCCATTGTTTCCCATCAAGGAAGAGGCGGTTGAGCTCATCCTGAAAAAATACG
AACAACACCTGAGGATGTGCGCTGGCGAATCCAGTGTAGGTGGCGACGCTATATCCTTAGTCCCCACTCCGAGTATTGGA
GGGGTGAATGGCAGCAAGGAGACGATGAGCCAAGCCGTCGGCAACACGCAGACCAACCGAAGATTACCAGCAAGTACACG
GAGGAGACCACAAACGAATAGCAATGAAGAAACATTTGCCTGCCCGTACTACAAAAAAGACCACATAAAACACCGGAATT
GCACTAGGTACATCATCTCAAGAATCCGAGACGTCAAGCAGCACCTGAGGCGATACCATGACATGCCAATATACTGCTCC
ATATGTTACGAAACATTCAGAGATGAGAGCCGGAGAGATCTTCATATAAGGGAAAGATCCTGCTCCAGAAATGCGAATTC
GCCACCGGACGGCATCAACGCCATACAGCGCAGACAGTTGGCGAGAAGGGTTCCTGCTAGCCAAACCCAAGAGCAGCAAT
GGTATGGAGTTTTCGAGATACTGTTTCCCGCCCATCCCAGGCCGAGTTCGCCGTATATCAACAGCGAGCTACTCCGAAAT
GCTCTGACTTACCAGGATTTCATCATGAGCCACGGGATTCGGGATCTAACAGACTTTGTGATGCAAAGATTCGGGGGGGT
CCTCCCTGACGGATTCGAATCATTACTGGAGTCTGCTACCCGCGATGGGATGGAGATAGTTTTCTCTAGATATACATCTT
TTGGAAGTACTTGCGGATTGGGAGACACGGAGGCCAGCCAAAACCTAATTGCACCGCCTCAACCGGTTGCGAGCTTTGAG
GAGCTCAGTGTTGTATCTGGTCCTTCTTATACTATCAGCAGCAGCCAAGACTACGATGCAAGTTATCCCTATTCTAATGG
TCCCTGGGGGGTCAATGGTGGCAATCTCGATGCGCAGCTAGATCCAAATGGATATGCGGCTTTACCGCCGGCTGCACAAA
CAGATACCTTAATGGGTGCGATAGGTTTCCCATCGAATACGACGCAGTACACTAGAGGACTGTACGATGGTGGGCAGCTT
GATGATCAGATGCAACTGCAGTGAATTTTGGGCGCCGTTTTAGACGTGTTATACAATATACAAATACACACCATTATGCC
ATCGGTTTATTTATTTGCTTTGGTGTCGTTATCTAGCGGTACGGGATGATGGCTCTGGATGTCGATTTGCAGGCGATTGG
TGTTTACGAAACTTGGTGATAATTCGATCTAATCCAAATTGAAGATTAAAAAAGAGAGATCATTTTTCGCGAAGGTATGA
CGGACGGTACCTTGCCAGTCGATCAAATCGAGCATCCATTCTCCTGAACATGGGACCATTGCCTTAGTGATTCACCGAGT
TCCAATTTGTAGTCCATGTTCCGTTTATCGCTGCGACCTGGGGGACACGCGCCTGAAATCATGATAACGAAGACGGTGCT
CCGACTATCGGTGCCTCGATAGAGAAAGAGCACGTCTCACGATGTTTTCGCACTGTATCCAAAGGCCGTACCTGCCCTTT
CCGTCATACTAAGCAGGACTAGATTGCTGATTCGGTCTTTCTTTCACTCCTTTTAATCCCTTGTTCTCTCGTCTTCCGTC
TCCAGATCTCTCTTTTTTACAAACCACATTTTCCATCACTGACGCTGCTGTCTCGTTTACGACACAGCCACCACCACCAA
CCACCACTCTTCACCTCTCTTTACTCTCGTCACCTCCTCCCCTCCTTCTACCACCGGCCTCACGTGGCCTGTCAGCATGT
CTGACGTCGCCTAGATTGCAGTGGCAGTTGCTAGCATCGCCATGACGGCAGCTGTCGTCTTGCTTCTCGAAGCCTACGGC
TTCGTCCAAAGATTCGGTGACTAGCGCCAAGCCGAGCAAGATCGCCTAGAACGCAGCCGGCACAACCTAGGCCTTGTACT
TCCCGGGCAACTGGGTGGCGAGGCCAACGCCGCCGCCAATGCTGCGGCCTCTGGTGCCAACTCTCTGGCACCTCGTCCGT
TGCGCCGCTCGCCGCGGAACCACACACCTGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62