GenePrediction:GLEAN_307 Details

Name: GLEAN_307
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:935351..936543 (+ strand)
Length: 1193
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:935351..935555 (+ strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_167:935628..936286 (+ strand)
Length: 659
Type: CDS
Source: GLEAN
Position: GCSC_167:936337..936543 (+ strand)
Length: 207
>GLEAN_307 class=GenePrediction position=GCSC_167:935351..936543 (+ strand)
ATGGCCTCCCGACCGACCGTCACGATCCACGGTGCCGATGGCAAGCCCACCAGCACCTCGCAGCCCATCCCGGCTGTGTT
CCTGAGCCCTATCCGCCCGGACATCGTTCAGCAGGTGCACACCGGCATGGCCAAGAACAAGCGCCAGCCGTACTCCGTCA
GCGAGAAGGCCGGCCACCAGACGTCTGCCGAGTCTTGGGGCACGGGTTCGTATTTCTCTCGGAGACGGGTGAATGGATGA
GATAGATCATCGTGCTGACAACGCCATCACCCTGCAGGCCGTGCTGTCGCCCGTATCCCGCGTGTGTCTGGTGGCGGTAC
TCACCGTGCCGGCCAGGCTGCCTTTGGTAACATGTGCCGGTCCGGCCGCATGTTCGCGCCGACCAAGATCTGGCGCAAGT
GGCATGTCAAGATCAACCAGGGCCAGAAGCGGTTCGCCACGGCCTCGGCCGTTGCTGCGTCCGGCGTGGCCCCCCTGCTG
CTCGCCCGCGGCCACAAGATCTCGAGCATCCCCGAGGTTCCCCTGGTCGTCGACTCGGCCGCGTTTGCCGAGGCTGCGTA
TGCCAAGACGGCCAAGGCCGTTGCTCTGCTGACTGCCCTTGGTGCTGGCGACGAGCTCAGCAAGGTTCGCAACAGCAAGA
AGCTGCGTGCCGGTAAGGGCAAGCTCCGTGGCCGTCGGTACCGCCAGCGCCGTGGCCCGCTCTTCATCTACGACCCCGAG
GTCGACGGCAAGGAGCTCGTGCACGGCTTCCGCAACATTCCTGGCGTTGAGACCAACTCGGTCTTTGCGCTCAACCTGCT
GCAGCTGGCCCCCGGTGGCCACCTCGGCCGCTTCGTCATCTGGACGTCGGCTGCCTTTGCTGCCCTCGACAAGATCTACG
GCTCGACCACGGCGCCGTCGGCCCTCAAGAAGGACTTCCTGCTACCGTCCAACATCGTGTCGCAGTCCGACCTGACCCGT
ATCCCATCAACTCTACCGAGATCCAGAGCGTCCTGCGCGCGCCCAAGGGCGAGGCACGGACGAAGCGCGGTGCTGTTCTG
AAGAAGAACCCCCTGCGCAACAAGCAGGTGCTGCTGCGTCTCAACCCCTACGCTGCCACCTTCATCAAGGAGAAGATCGG
CCAGCAGAAGCTCAAGACCGAGAAGGCCGCTCCCGTGCCGCCCAAGTTCAAGCAGCTGCTGAACGAGGTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62