GenePrediction:GLEAN_3089 Details

Name: GLEAN_3089
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:142740..144546 (+ strand)
Length: 1807
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:142740..142805 (+ strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_161:142886..143563 (+ strand)
Length: 678
Type: CDS
Source: GLEAN
Position: GCSC_161:143636..143737 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_161:143789..144103 (+ strand)
Length: 315
Type: CDS
Source: GLEAN
Position: GCSC_161:144165..144331 (+ strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_161:144384..144546 (+ strand)
Length: 163
>GLEAN_3089 class=GenePrediction position=GCSC_161:142740..144546 (+ strand)
ATGATGGAAGCTCCAAGATACACAAACTATGACTTTGGCATAATTGCCGGTGCTGCAATTGGCATGGTATGATTATCTTT
CTCTTCCTCTCTTTCTTTTGGGATCTTATTAAGGCTTCCGTTCCCAGAATCTGACAGTATTGGCAGGCGTTCCTCCTAGC
CTCTGGATCTATCGTTTACAACCTCTTCCTCCACCCTCTTCGCAAATACCCCGGTCCAATCTTGTACAGAGCCACCAAAC
TGGCCTTTGCCCTCAGGCTTGTGCGTGGAAACTTGCCACATCACGTTCTTGCCTGGCATACGAAGTATGGCCCCGTAGTC
CGAATTGCGCCCGATCAGCTGGCGTTTTCCGATCCCGAGGCCTGGAAGGATATCTATGGCCACCGGACAGATCCACTGGC
AGGGAAAGAGGAGATGCCGAAGCTCGATCTGTTTTTCCGGACACCAGGCATTCCTGTCTCTATTGTTGCTGAGTCTCGGG
CGAATCACACGAAGCTGCGGAGGTTAATGTCCCACGGTTTCAGTGAACGGGCTATGCGCGAACAGGAGTCCCTCATTGTT
AGCTACGTGCAACTGCTAATTCGCCGCTTACACGAGAAGTGCTGGACCTCGACCAAGGACGTTACCCTCTCCGAGAATGA
CATCAGCGACAGCACGCAGACGCTTAAGCTTCAAGTTCAAGATATGAACACATGGTACAACTGGACCACTTTTGACATTA
TCGGGGACCTGGCTTTTGGGGAGTCTTTTGGCTGTCTGGATAACGCCGTCTACCATCCCTGGATCACAGCCATCATGGAC
TCAATCAAGACGGCCGGCATGTTTGTAGCTGCTAAGATGCTGCACTAAGGAGCGCCTATGGTGTTGATGCTTCATCTCAT
CATGCCTGGGCGCAAGGATGCGCTGGCTTTCAGCCAAGAGCGCGTAAAGCGGCGTATGGAGCTCCAAATAGAGCGTTCCG
ACTTTCTCGATGGACTAATACAAAAGAAACAAGGCCAGGTAAGGCAATGCTACCGAATCTTTCGCAAGAGTTGCACTAAC
AAAGCTTAGCCGCTTGCTTTGGCGTGTTTGACTACCAATGCTAGCCTTCTGGTTTTGGCAGGATCCGGGACCACGGCTAC
CCTTCTCTCTGGCGTAACCTACCTCTTGCTGAATAATCCGCAGTCCATGGCCAAGTTAGCGGCAGAGGTACGGTCCAGCT
TCTCCTCGGAAGAAGAGATCACACTACTATCTGTCAACAAACTGACCTACATGCTGGCTTGCCTTAACGAGGCACTTCGT
TGCTACCCGCCTGTTGTTTTCGGATTACCGCGCGTTGTGCCAAAGGGTGGCAGCAATATTGCTGGTCACTTTGTTCCACA
AGGTGTATGTAATCGTAGCCGAAGACGAATAATTGTGTTTGCACGCTAACAGAGGATCGATGCAGACCGTTGTGGCATGC
TGGCAATGGGCCATGAACCACATGCCTGAGAATTGGGAGGACCCGTGGAAATACAGCCCAGAACGCTTCCTCGAGGACAA
TCCAAACACGCGAGATCGCCTAGAGGCGATGCAACCCTTTAGCGTCGGTCCAAGAAACTGCCTCGGCCGCAAGTATGTTT
CGCTCTTCTGCTGGTAGCTTTTGGCTCAGATGCTGACAATACAGTCTTGCTTATGCTGAAATGCGCCTCATACTGGCCCG
CATAATCTTCAACTTTGACTTGCAACTGGCAGACCCCGATTTCGACTGGTTAAAAAAGAGCACGGCTTTCATTTTGTGGA
AAAAGCCGAAACTGAACGTTTTTCTGAATCCGGTCCGTGCTGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62