GenePrediction:GLEAN_308 Details

Name: GLEAN_308
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:942036..946972 (+ strand)
Length: 4937
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:942036..944819 (+ strand)
Length: 2784
Type: CDS
Source: GLEAN
Position: GCSC_167:945176..946972 (+ strand)
Length: 1797
>GLEAN_308 class=GenePrediction position=GCSC_167:942036..946972 (+ strand)
ATGGCCGCCAATGGTTCTGGCGCGTCGCCGCCTCTGCTACCATCGTTCCCGTCTCTCCGCGAGGCCGCTCCCACGCCGAT
CGCCCAGCTCGAACCCAACCTGGCGGATCAGCCCGGCCGTGTCGTCTCTGGCCAGGTCACCATCGTGTGGCCGTACAACT
CCGTCAAGCAGTCGCTAGCCTTCCTCCTGGCTGAGTCCGATGTGCGGCTGCGTCGCTCTCGCGGCCAGGTGCGCGTCTTG
CTGGACGGTCCCAGCGCGGCCGCCGTTGCCCAGAGCGGCCTGGGCGGCGGTGATGAGGTGCTGATGAGCCTCGACGGCGT
CAGCTGGTCGCGAGACGAGTCGGCAACGGGACCTCCTGGATCACGTGTCGAGTGGCAGCTGGAGTACGGCCTTAAACTGC
GGCTTGAGGCCAGAGTCGGCGAGGCACAGGAGCTGCACAGCATCCACATCGATCAGCCGCCAGCTGCTCATCACGACGAC
AACAGCAACCAGAACCACGACAATGTCCCGAAAGAAGTCGACGAGCACTCGACTGCACCGCTATCATCAACCTCCACACC
TCCACCACCACCACAGTCATCATTGCGGCCTGCCCGCACGCTCCTCAGCAAAAGCGACTACCCCGAAGAATACGCGTCGC
CGGCCTTCATCAAGCGTGCACGCATCTCCTTTGGCTCGCTGTTCGAACCCGGCTTCGACATCTTCGAGGATGATGGAAGT
GTGCGAGGCCGGGGTCGTAAGCGCACACGCTTTGGTCGGGCCAGCAATGCCTGGCGGTACAGCAGTCAGTCTGTAAGCCC
GGAGCGCGAGAACGGGCTGCCGCCTGGCGAGCAAACGGAGGCGCCTTCTGCCGTGCCAGAGAGTCTGGCAGGACCACTGT
CATCAAGTCCGACGCTCCTAACAAATGAGCCCGTTCGGGCTACCGATGCGGTCATGGAAGACGGCCAGTCGTGCGTTGGT
GTCTCTGTTGCCATCGCTGCTATTCCTATCGACTCCGCTGTCGACCAGACGAGCGCACCGGCCGCTCTGCCGTCTGATTG
CGAAACGACGTCAAAGCAGCCCGGCATGTTCTCGAACGCGCTCTTCGGTGCCCCAGTGCCATCGATCAGTGGCGCGTTGT
TTGCGGCTCCGCTGCCGCCAACCGCGAACCCACCTGGTGCGGATGCCATGGGCTTTGTGCCTGACGACGCCTTGTTTGAC
AGCCAGGTACGGTTTGGGTTTGGACACAATCATCCTCAGAATCCCGTCGCGGCACCGTTCGTGCCCCAGTATCATTACCC
AGAACCTCCGTCTGGTCAGCTGGAGAGTACGATGACACCGACGTTTCCACCAGACAGCATGATAGCAGAGATGGCCGAGG
CCCACCAGTATGGTCTGGAGGAACTGCCAGCGCACCCCCTGCCATCCATGACTCCGGTGCAAGCGGTATGGCCCATCGCA
TCCGAGTCAATGGACGCGCGGCATGTGGAAGACCACATTGTTGCCAAGCCAGTACCAGAGCAGCGTGCATCTCCGCCTGG
TGAAAACGTTGAGCAAAACGACGAGACGACCGATCTTCCCCGTGATGTAGACACGTACGGATACAACGACAGACGATACC
AAAATCAAGCGGAAGAGCGCATGGTCGGCATGGTGGATTCTGGCGAGGCAGCTAGCACTCCAGTGGAAGAAGTGGAGCCT
GACGTTGATGACGAAGAAGCTGAAGGGGAAGAGGAGATCGGAAAGGGGGCGGACGATGTTGGTGCTTCGGATGAAAGTGC
CGGGATCGACGATGCGGGTGATGACTACGACATGCGGAATTATGTTGATGTAGACGACGATGTCGAAGGCAACGCGCTGC
CAGATGAGAGAAGAGCGGCAACCTTTGGCGGAGAAGCAGACGATGAAGAGGAGGGAGGGGGCGATGAGGAATACGAAGGG
GACGATGCTGCCTTTGAGAACGGGTCACAAGAAGACGCGGAAGGCTACGACGAAGAGGAGGGGTTTGCAAGTCAGGAGTA
CGACGAAGACGAAGAGGACGAGGAAGAGGGATACGAAGAAGACGAGGATGCCGACAAGGGACAGTCCATTGCGCAGCATC
AAGAATTCTACCGCACGCAAATGCAGCCGCAGCAGCCAGTTGTTATTGACCTCCTGTCTGACTCGGATGACGACGAGCCG
CCACCTCCTCCCCGAGCACAGCTGACACCGCCTACGACGAGCAAGCCGGTTGTGCTGGCTTCTCGGGGGACTCAGGCCAT
ATCGGATGTTGAGGGCGAGGGCGAGGAAGAGGGGGGTTTTGAGGGTTCCGAGGTCGATGGTGATGTAGATGACGAGGATG
TAGGCGAGAGTGAGATGGAGGAGGACGGAGAAGACGACGAGGAAGAGTATGACTCTGAAGGCCTTTCTGGAGACGACGAC
GGTGGTGAAGAGGGGGCCTTGCCAGAGGAGAAAGAACAAGAGGACGATAGGGAGAGTCTGGAGGCAAAACTTGAGGCAGA
ACTTGAGGCAGAGCTGGAGGCTGAGCTGGAAGCGGAGCTGGCAGCAGAGCCAAACAGCGAGGAGAAGGAGGAGCCGACAG
AGATGCAGAAAGCTGAGCCGAGAGAGAAGCAAGTCGAGCCAACGCTGGAACAAGCAGCCGAACAAGTAGCCGAGCCGGCG
ACCAACGCGGCGACAGAACTGGCGACAGATCTGGCGACTGAACCGACGATTGAACCGATGATCAAATCGGCGACAGAATC
AGCAGTTGAACCGACGGCCGAATCGACGACAGAACCGGCAAAACCAGCAGAACCAGCAGAACCGGTAGAACCAGCAGAAC
CAGCAGAACCAGCAGAACCAGCAGAACCAGCAGAACCAGCAGAACCAGCAGAACCAGCAGAACCAGCAGAACCAGCAGAA
CCAGCAGAACCAGCCCAGCAGAACCAGCAGAACCAGCAGAACCGACAGCATTAGCAGCTGAAACCTCACTGGCGAAAGAC
CATGATGAGCAGGAAGACGTCTTGGTATCGGAGGCACCAATGTCACCAGCAAATGACAGCAACGTCGTGGCCGCGAAAGA
AGAAGAAGATAGGGAGCTAGATGAGGTTACAGACGAACCAGAGGCAGATGAGCTAGTGGCAGACGAACCAGAAGCCAACG
CAATTCCGACAGGGGTGCAGCCAGCAGAAACGGAGCCGACTGAAACGAAGAAGCCAATGCCAATCCCAGCGGCTGCTCAA
GAGGAAACAGAGCCGACGTCTGCACAGCCAGCTTCGCCACCTCCGACGCAGTTATTCGCGTCCCAAGATTTTGGTGTCGA
CAGGACTGCCATTCTGTCGTCGCCTCCTCTAGCCTCGCAAGCCACAGACGCAGGCCCGGAAGTAGAAGCATCACGATCAG
AAGAGTCGTCACAAGCAGCAGAGCCAACCCAATTGGCGGAAGAACAACTCCCGACGCCGCTGGATACGCAAGAAATCGAC
AATGCTCAGGCAGAAATCCGGCTGCCGACATTTACCGTGTCCTCGCCATCAGCCATGGACGAAGACACCCAGATCCAGAG
CCAGCTGCTTTCGGAGATGGCCATGAGTTTTGAATACGAGGACCACAATGTGACCGACACAGACATGGTGAGCGTGGCCA
GCGAAGTGGTGCACGATGTCGACATGGACGGAGAGCGGCAAGACGACTCAGAGCCAGAGGATGACATGATTGTTGAGGAA
GTGACCTCGACGGCAGCAGCGGTAGCCGTCCAGACGAGCGATGACGATGCCATGGACATGGATGCAGCGGACGTGGATAT
GGAGAGCACGACATCGGAAGATGCGATCGTGGTGCTGGAGAATCCTGTTGACGAAGACGTCCCTGACAAGGACATGGGAG
CCCAGTCACAGCTCGAGTTGGAATCTGGCGTCGAGTTGGTCGAGTCTGTGGTTTTGGTAGCTGCTGACAAAGCACCTGTA
ACCGAAACGGAGCCGCCATCAACTCCAGTCCGGCTCATGCATGCTGGTGAGGAGGAAGAGAGCACGACGGCAAGCCAGAC
GGAGCTCAGCCAAGCGGGGCGGCATAAGATGTCGCTGCGATCGAGTGGTGGCCGGTCGACGGCCCCGAGCAGCAGTCCAC
GAGCGACGGCCGAGGCAGACACAGTGATTGTGGCAGCGGTAGCGACTGCTGGACTGGCGGGAGACGATGGCCATGCGAGC
ATTCTTCTGGCGAAGGCGTCGACTCAGCGGAGCAGCAGACAAAAGCCGGAAGAGGAGGTAGAAGAGGACAAGGTGGTGGA
TGCAGCAGTGAAGGAAATGAAAACGGACGCGGATCAAGAGGTCAAGGCTCCCTCGAGCCTGACAGATGTCGATGAGACCG
ACGTCAGCGTGATGCTGGCGCGGACGGCGACGAGCACGCATGCAAGCAGGCCGCGTGGTGGCAAGGCACTGCTCGAGACG
TGTCAAGCACAGGTGCCCGACTGCGTGTCGCTGCACAGACTGCGGCTCCATCTGGCGCAGCTGGTCGACGTGGCCGTGGT
GGCGGTGGAAGCATCGCCGGCGGCTGAGCGGACCAAGACGCGGCAGTTTGCCATGACCTTTACGGTGACTGATCCGACGG
TGGTCGAGCGAGGTGAAGACGGAAATGAGGAGAAAGAAGCGAATGTCGTCGAAGTGCATCTCTTCCGGGCCCACAAGAGT
TCACTGCCGACATTCCGTGCCGGCGACGGACTGCTGCTGCGCCGGTTTGCCGTCGTGGCGCTGGCCGGCAAGGGTTTCGG
GCTGCTGTCGGGCGACGAGTCGGCGTATGCCGTGTTTGCAGATGGCAGCGAGGAGGCCGTCCAGGTCAACGGTCCGCCAG
TCGAGGACGTTGATCGCGAGGCAGCGTATCTCGAGGAGCTGCGGCTGTGGTTCGCGCAGCTGGACGACAGCAAGCGTGCA
CCGATCGTCGCAGCCGGCGCCGCGTTTAGCGCACGGGGGAGGGAGCTGCAGGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62