GenePrediction:GLEAN_3090 Details

Name: GLEAN_3090
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:149556..151219 (+ strand)
Length: 1664
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:149556..150081 (+ strand)
Length: 526
Type: CDS
Source: GLEAN
Position: GCSC_161:150370..150532 (+ strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_161:150886..151219 (+ strand)
Length: 334
>GLEAN_3090 class=GenePrediction position=GCSC_161:149556..151219 (+ strand)
ATGACGCAGTTTGTCGTCGCCTGGACGGGTCTCGAGACTTCGTTGGGCGCCATAGCCCGTATAACACTCTTTGAAGGCGA
GAGACCAGCCGAAGAAGACAGCGGCAGCCTGGAGTCAGGAGTCCCTCTGGAAGCCGAGGCCGTTCGTGGTCCTGGCAGCG
GCGCCCTACGCTTTGAGAATGTTTGGGGAACGTACGATGCAAAGGCTGGTTGGACTGGGGGATTGGACCGAGACTCCTCG
CATCTCGGCCGAGAATGGAGTCTCCGAGGCGTCAGTCTAGACGTAAAGCCCGGTGAACGCATCGCTGTATGCGGAAAGAC
GGGCTCTGGCAAGTCAACAATGCATCTGGCGCTGCTGCGGATGGTCAATATGCCGATTGGATCTATCTTCATCGATGGGA
TAGACCACTCCAACATTTCCCTGGAGGCTCTTCGAAAGGGCTTCTACGCCATTTCCCAAGACAGCCTGGAGGGCTTCGAT
CATTTGCGCCAGCAGCTAAACCCCATTGAGGCCGGATCAGACGAGAGTTTTGAAAGCATTCTGCGGGGCACAGGCGTTTT
AGACATATGGCTGAGCACACCCGGAGGACCAATGGCCTGCAGGGGGAGAAGTAAAATTTTGGGCAGGAGATGGCGAGCTG
CTGAGCGTTGACCGTGTGATCCTAGACATGCAGAGGAAATCCCAAGTGGTGGGCCGGAATGGGGCGTAATCGGGTTGCTC
GACCAAAGCTGCAAGCAGGTATGTTATAAGGCGTGCTTTGATGATTAATACAGTCGCTGTTATTGTGTACTGACAGCTGT
TTGTCGTACTGCAGCGTCGACAAGAAGAACGGAAGAGAAGATGGAGATGTTGATCAGAGCCCGTCTAAACGGAAGGACAC
TTATTGCTATCAACCACAGGCTTGAGGCAGTGATGGAATATGACCGTGTTGTAGTGCTACACAACGGAATGGTTGCTGAT
GTTGGTACGCCGGCAGAGTTGGTGATGCGTTGTGAGCTTTTTGCAGGGTTACAGGCCCAAACTTTCGTGGAAGACGCGAC
TAATTTGCCGTGATACGCCAACCCCTGCTGAGTAATACTAATTTTCAAGGATGACGGAGAAATATATTTCCATAAGCACA
TCACTGTGGAGTCTACGTAGGCAACTGTTGTTGAATCATTGGGATTATGGCAGAAGATGCGTCCGGAACTTTTCATCGTG
ATAGATACTGAAGCAAATGTCAAAGCAGCTTGCAGAAAAGGTGCTAGCAGAGTCGTCGGAAAATAGCTCCTCATCAACAT
CAAGCTTCACTTGATAGTACCATTGACTTCTCACAACAGCCTTCAAACAGACCTGCCCAGCATGTTTTGGCCAGTCGGCG
CTTTGCCGCTTTGACCAGTCGTTTTGACGTTGGTGACGGTCGCGACAGCGATAGCAATGATTACGACCGTGTGAAGCTCG
TACGGCTAACGTACGAGTACGCACGCTCTGAGGAGTCAAGAAACAACTTTCTGAGAGCCTCCTTCGAGATTGCGTCTCTC
CCGATGGACACAGAGGAGGACAACCTGGATGGTGATACAGAACATCTGCATGATGCCTTGATCGACTTTGCAGACTACCT
ATTCGACAATTTCTTCTTGCCGAGTATGGGATTATCGTCGGCTTGTTTTACCATCCATTGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62