GenePrediction:GLEAN_3094 Details

Name: GLEAN_3094
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:163449..166882 (+ strand)
Length: 3434
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:163449..163923 (+ strand)
Length: 475
Type: CDS
Source: GLEAN
Position: GCSC_161:163984..164792 (+ strand)
Length: 809
Type: CDS
Source: GLEAN
Position: GCSC_161:164849..164956 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_161:165007..165255 (+ strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_161:165308..166882 (+ strand)
Length: 1575
>GLEAN_3094 class=GenePrediction position=GCSC_161:163449..166882 (+ strand)
ATGGACCACACATATTCCCGGTCTCATCGCGAGAACACCATACGGGAAACCAAGCGCCTCATCACCTCTGGGAGAGCTAC
CTCTGCTGCATCTGGCAGGGGACTCCAGAACTGGCCATGTTCGGGCATTGGGAGGCTGACCTTTGTGGTTTCCATATTTC
TGATTTATTTATTTTATGGTGATATAGTGCGAGATAGGATCGCTTCTTCGAAGGCCAGCCATGGTCCGAAGGATAGTATC
ACGAAGAGTCCTTTGTCGGGCTTTGAAAGTCCAAGCAATGCGTTCCGTCCGCGCTTTCGATACTGGATCCCGGATGCTCA
TGTGAACACATCGCGAGTAGCAGCTGACATTGCTGAGGCCGGTGCCCGTGGGGCCGCAGGTGTTGAAGTCCTTGGGTTCT
ATCTGTATGGTGGTGCTACTGGGGAGTATGTGCCGGTCGATTGGAACGAGTATGGATGGGGTACTCCGGCCTGGAGTAAG
AATGCATCTCAATCCTGTCTGTACCGGTCTGATATGAGCTAACGAGGAAAATCAGAGAGGGTTCTCGATGCGGCGATTCA
AGCCCATTTGGATAACGGCCTGCTAATGGACTTCGCCGTGGGGCCCAACCAAGGCCAAGGAGTGCCTGCTGAAGAAGACG
ATGAGGGCTTGATGTGGGACTTGAGTCCCTTCGCAGCCGACGTCCCACTAGGAGGCAGCTTTGATGACGAAATCCCCGGA
TGGGGCACTGGAACGCTCGAGGCAGTTGTGACCGGAACTATAATGGAGACTACGCACAAGCCACGAGGCCATCAGACAAA
CACGTTGTCAACAAGTAGTCTCCAGGACGTCACGAGTCAGGTCTCTGACGATGGGCATCTGCATCTCGACTTCTCCGACT
CTGCTGCTAGTATGGCTACCTCAGCCGGGCTGCGACATGTGGTGTATGCAGTGTATCTTGTGCGCTCAGGAACACGGAAC
CAGCTTCCTCCTGGAAAGTTGACAGGCCCACAGACAAACCCTACAGACTATCTCCATAACGGGTCGTGGGTCGTGGACCA
TTTCTCTGCGCGTGGGGCCAGGGTGATCACGCAGTTCTGGGAGAAGCACCTGCTCGTAAACGGGACCAAGGAACAGCTGC
AGCAGGTAGCAAGATATGCGTGGGAGGACAGCGTCGAGATCGACCCGCGAATCTACTGGACGCCTGATCTACCTATCGCG
TTTCGCCAGCGGCGTGGTTATTCCATCGTTCCGTTCTTTCCCATCCTGTTCCACGGAAACAGCTTGACGGAACATTTCGA
GTCCTGGTTCGTCACGGACGAGGAAGATGCTGGACAGTCCCATGTGGCCGACTACCGGACTACAGTGAGTCCACTCCCCG
TGAAAAACAAACCGATCTTTCTAATCCTTTGTCAACACAGCTTACAGAGGGATACATGGAGTATCTGGAGGCACTCGACA
GATGGGCCAATGAGTCGCTCGGGATCCAGTGGTCGTCCCAGGTTGGCTACAATATGGCTGTTGACATGGTTTGTCTGATT
CCGAGGGTTCCATTGGTATTATGGCTGACGGCAAAAAGCAAACGGCCATCCCCAAGATTGCCGTACCTGAATGCGAGGAT
CTTGCCTTTGACGAATCGATTGATGGCTATCGACAATTTTCAGCACCGGCCAACATGGCAGGAAAGCCGGTCATCTCGGC
TGAAGTCGGTGCCGTGCTCGGCCAGGCATATCAGCTGAAGCTGCCCAAATTATTGACCCTCATCAAGAGGCTGTATGCGG
GCGGCGTCAATTCCATTATGCTCCACGGTCTGTCGTATTCTGGGGAGGTGAGGTTTATGACAGCCATTCACTGTGTCTGA
TGTCTGCTGACAATATCAGTATCCAAATACGACATGGCCGGGTTACGCAGCCTTTACGTACGCCTGGTCCGACATGCACG
GACGCCATCAGCCTGCGTGGGATTTCTTCCGAGGTGCTGCCCTCGATTATCTGGCCCGAAATAATATTTTCTTGCAGGCA
GGGGTGGCCAAGACGGATCTTGCATTCTATCAGAAGCGTACCACCTACGCCGAGATTCCAAGCAGCTACGAGAGCGACGA
CCTGTCCAGCAAAGGATACACGTACGGCTACCTCAACCCAGAGAACCTGGCCCTGCCCGAGGCGGCTGTCGGGAACGGTG
TTCTTGCTCCGATGCGGCAGGCATACCGGGCTCTGATTGTGCGTTGTGATGACCTCATGACAGTTACTGCAGCCGAGATG
ATTGCAAAGGCGGCCCTGGCCGGTCTTCCAGTCATCTTTTACGGTGGCTTCCCCTCGACTATGGCGAGCTACGATCCGGC
CGGCAGTCTATATGTCAACAGTACTCTAGCTTCCATACGGAATCTGAGCAACGTTCATGAGGTACCAGAAGAACTAGGCC
AGCCCAGCCTGGCCAGCGTGGTTGAGTCGCTGGGTATCCAGCCTCGCGCTCGGGTCGAGGCTGATGCGCCCTGGTGGCCG
GTCTGGCGCGAGACCACCGATGGCCTGGAGCAATACGTCTTTGTCTACAACAGCGGAGAGCACAACAGCGCAGGAAACAT
CACCTTCCAGACGACCGGAAAGCCGTACCGCTACGACCCGTGGAGCGGTGCAAAAAGGCCGGTTTTAAACTATACGTGCA
CAAACAATGATACGACGTTGACAATCTTCTTTCAGCTCGCCCCAGACCAGACGATGCTCGTCGTCTTTGACAACGACAGC
GATGAAACCACCATAGCATCATATCACGTGACTTCCACCTCGGACGGCGTTCTCGACATTCTTGAGGCCTCAAGTGGCAG
TGGCTTGGAGGCTCACGTGGGCCACACGGGACGCACCTCTGCTGACTGGGTAGCAACCTCGGACGGTGAGGTGCACCAAA
TGTCTCCGACGTCGGCAAAGCCTTTCGAGCTGCAGTGCTGGAATCTGACAGCGGAGCACTGGGACCCTCCGACGCCTCTC
GTCGATGTGGTGACTACGGCCACGAAGCACAACACGACCCACCAACTAGACGAGTTGACATCGTGGCAACGTATTGACGG
CCTGCACAACGTCTCTGGCCTGGGTTACTACACCGCCGCATGGGAATGGCCTCCCGCAGATGATGATGATACCTCTGTCA
GCGGGGCCCTCCTCTCGTTTGGTGCCGTGGACCACACGCTGGCTGTGCGCGTCAATGGCCACACAGTGCCTGCGCTTGAC
GCCGCCGATGCTACGCTCGACGTGACCCCCTACCTGGTTACGGGCTCCAACAAGGTCGAGGCCGTCGTCAGCACGACGCT
GGCGAACGTGATGGCGTCCATCTGGGATGAGCTGCTCTCCAGCGGAGCGCCACCGACCGGTCTCTTTGGATCCGACACAA
GACCACCGGGCGATGCTGATTATGGGTTGCTAGGACCTGTCGTTGTCACGCCTTATCGTACGGTTCTAATATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62