GenePrediction:GLEAN_3095 Details

Name: GLEAN_3095
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:170348..171297 (+ strand)
Length: 950
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:170348..170435 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_161:170505..170830 (+ strand)
Length: 326
Type: CDS
Source: GLEAN
Position: GCSC_161:170902..171019 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_161:171095..171297 (+ strand)
Length: 203
>GLEAN_3095 class=GenePrediction position=GCSC_161:170348..171297 (+ strand)
ATGGCTTCCCTACCGCCTGCTGATTGCTGTGTCCGAGGCGTCAAGCACGACGGCTCTCCCGTCGGGACTATCGAAAAGAT
TGACGGCAGTCTGTCTTCCCCTCACTAGAATTTCCACCTGCTACTTTCCACAGAGCCAAGCTGATACCCCGCCCCAGTCG
ACACGTACTTTGCGCGCCCTGCCAACAACGCGTCCGACACGGCCATTCTCATCTTCACCGATGTCTTTGGCATCTACAAG
AACGTCCAGCTGATCGCCGATGCCTTCGCTGCACGCGGCTATCTGACCGTCGTCCCCGATCTCTTTGATGGCGACACCAT
CCCTCTTGCCGCCTTTGAGAGCGGCACCTTTGATTTCCCGCCCTGGCTGCAGAAGCACTCGACGGCCCAAGTTGACCCCA
TTGGCGAAACCATCATCAAGCACTTGCGAACTACGCTCAAGGTCAAGAAGCTGGCTGCTGTTGGCTACTGCTTTGGTGCC
AAGGTACGCCTAGCCGAGCCGAGCCAGGTACTTTGTCGATCACCATGCTAATTTTTCGTTCTTCTCCCTTGCAGTATGTC
GTCCGAAACCTCAAGGCCGGCATCATTGACGCCGGCTTCGTCGCCCACCCTTCTTTTGTGACGCCTGAGGAGCTCGGTGC
CATCACGCAGCCGCTGTCCATTGCTGCTGCCGGTAAGACCCGCCTGTATTGCGCAGTGTCATTGTGCAATCGCTCTTAGT
CTCAAATGTACTAATGGAGGTGTCTAGAAATCGACAGCATCTTTACAAACGAACTTCGCCACACGTCAGAGGAAATCTTG
GCGAAAATCCAGGTTCCTTACCAGATCTTCCTATACGGAGCTGTGAGCCACGGCTTTGCCGTCAGGGGAGACCTCAGCGA
TAAGAAGGTCAAGTTCGCCACCGATCAGGCTTTCGAGCAGGCCGTCAAATGGTTCAACGCCTGGTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62