GenePrediction:GLEAN_3096 Details

Name: GLEAN_3096
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:176250..178183 (+ strand)
Length: 1934
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:176250..176480 (+ strand)
Length: 231
Type: CDS
Source: GLEAN
Position: GCSC_161:176540..178183 (+ strand)
Length: 1644
>GLEAN_3096 class=GenePrediction position=GCSC_161:176250..178183 (+ strand)
ATGGGCTCTATAGACAGGAACGAGGCGGCCGTGTTCGACTATATTGTCGCGGGCGGCGGAACCGCGGGCGTGGTGACGGC
GGCTCGGCTGACGGAAGATCCCAACATTAACGTCTTGCTGATTGAAGCCGGGGCCGACCGCAGCAAGGATCCCGCTGTGC
TTTTGCCGGGCATGCTTACTCAACTGTATGGGAAGCAGGAGTACGACTGGAGTTTTCATTCCGAGCCTCAGGTAGGTTTA
GAAGAATGAAGATCCCCCCAAAGTCTCACTACAGTAAAGCTGATAAGCAGCCCCAACTTTACAACCGCACAATCCATCAA
CCCCGCGGCCGTATGCTCGGTGGCAGCTCCGGCATCAACTTTATGATGGCCGTCTTCCCTAACCGCAAGGGTATAGATGC
ATGGGAAACGTTGGGTAATGAGGGCTGGTGCTACGACACCCTAGAGCCTTACTACCGCAAATTCTCAAAGACCCAGGCTC
CCTCAGCCGCGACGGCTGCCATCTGCCGCATGACGACGGGAAAGAGCTATGACCCGGCCATCACGGAGGCTGAGACGGGG
CCGGTGCAGATGTCGTTTGTGGATAACTTTAGCGCCAACAACTCGGCCTGGTTCGACACGCTTGAAAAGATGGGCATGGG
TCCAGGCACGGACTTCCGCAGCGACGACACCAGGGGCGCCTACCAGTACGCTTCCAGTATCGACAGCAAGACACACACGC
GCAGCTTTGCCACGACGGCCTATCTGACAGAGAAGGTGCGCGCACGTCCGAACCTGACCATCTGGACGGAGACGGTGATG
ACCAAGATCTTGCTGGAGGGACGAGAGAGCACAGACTCAAGCAATTCGACGACCGTGGCCACAGGCGTCCGTGTCCGCTC
CGACAAGCCGGGAGAGACGGGCGAGCGCGACGTCTTGGCCAGAGCCGAGGTGATTCTGGCTGCAGGCGCACTGCACACGC
CTCAGCTGCTCGAGCTGTCGGGCATTGGGCGGCGCAGTGTGCTGGAGCGCCACGGCACCCCCGTTGTGGTCGAGAACGAG
AATGTCGGCGAACATGTGCAAGACCATCCGCTGGTGCCGGGGAACTTTGAGGTGGCCGAGGGCGCCACATCGACCGATGT
GTTTCGTGATGCCAGCCAGATCGAGACCACCTTGCGGCAGCACTTCCAGGCCAACGGAAGCAGCCCGCAGAACTACAACG
TATATAGCGGAGCCTATGTGCCCGTGGTCGATGCCGACGGCCCGTTGTCGATCGAGGCTCGCGAGGCGCTCTTCGACAAG
TGTCTCTCGCAACAGGTGTCAGAGGCGGCACCGTCTGCTGGCGTGGCTGAGCTGCGGAACACCGTCAAAGACCTCCTGTG
CCGTCAAGACCAGCCGGCCACACAGCTGGTCCTATTCCCGGGTCGGATCGAGCCAACTACTCGGCCAGCCACCGTTACCG
ACTACGTGACGCCTGTCCAGCCCGAGAACTACCTGACCTTTTTGACCTGTCTGGGCCATCCGCTCTCGCTCGGCACCGTG
CACATTGCCTCCGACAAGGTCGAGGATCTGCCTCTCTGGGACCCGTGCTACCAAGCAGAGAGCATCGATCTGGAAATCGT
CTCCCGCGCCCAACGCTTCCTCCACAACTTTGCCAAGCAGGAGCCGTTTGCGAGTCTTTTGAAACCGCTCGCCCAGCAGA
AGCGCATGCCCAATATCATCTTCCGCAGCACTGACGACGACGACAGCCTTGAGCAGGCCCGCGAAGTCGTCCGGCTGTCG
CAAATGTCCAACTTCCACGTCTGTGGCAGCTGTGCCATGCGGCCCAAGGACAAGGGCGGCGTCGTCGACTCCCGCCTACG
CGTCTATGGCGTGCCTAACCTGCGCATTATCGACGCCAGCATCTTTTCCCCCTGGTGCCGCTCGGCAACATCCAGACGAC
AGTCTATGCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62