GenePrediction:GLEAN_3099 Details

Name: GLEAN_3099
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:189783..191972 (+ strand)
Length: 2190
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:189783..190733 (+ strand)
Length: 951
Type: CDS
Source: GLEAN
Position: GCSC_161:190851..191972 (+ strand)
Length: 1122
>GLEAN_3099 class=GenePrediction position=GCSC_161:189783..191972 (+ strand)
ATGCACCAACACCAACAACAACAACAGCACCAGGGCGATGCAGCCGCGGACGAGGTGCGCGACGAGATGGTCAAGATCGC
CATGAGCAGCACCGGCAGCATCGACGGGGCCACAATGGACCGACTGTTTGGCACCATTGCCATGATCAAAAAGGAGAAGT
GGCGACACCTTGGCAGCGGAAACGGCAGTACCACCAACACCACCTCCAACGCAACCGACCACCTGCGTCTTTCGGCCAGC
CTTTTCGCCCGTCTACGCCGCCTCAACCAGACACACTTTGACACGATAATGGTCAAGTGGCTGAAACGACTCCGCATGTT
GCGCGACCGGCCTGCCGTTGCGATCATCTATCCCGTCTTTGTCGTCTTTGGCTGTCTGGACCTGGCCAGCCTACTGGCCA
CAACGGCCGACGAGCAGCCACGTGAGCCGGGTGGCCCAGTGCAGTCGCCAGCTCGTAACACCTGGCGCACGTCGTACCTG
CAGGACGTCCTGGCTCTGCTCACGGCCCCAAAGGCCGATCGTGGCTCAGGATCTAGCTGCAATGCCACCCTGACCTGCGA
CGAGAACCAACGGTTCCGCCTGTTCCTGAGCGAGGCCCCTTTTGCGGCTCCGGCTGCCATTGCCGCTCTCGTGCGCAATG
CCGTGGCCGAGATGACCCAGTGGCGACGACAGCAAAACATGACCACCGCAGCCGGCCATCATGCGGCGCCTCGCAGCAGC
GTCGACGCCCTTGCCGTCTCACGGCTGCTGCGCACAGCTGCCGTAGCCGACGCCACCGCTGCTGCTCATGCGCTCGCCCA
GACGACCGATCAGGCAGTGCGGCGTGGACTCTGGGAGATGACCACGCTGGCTCTCACGCGGCAGGTAGTGCCAGCTCGAC
CAGCCCTTGACATGCTGCGCGAGCTCGACATCTTTGCCGCCGACATGGGACAGCTGGCCCTCGGCTTGGCTGTCTGGCCG
CCACCGTCGTCGCCGTCGTCGTCGTCGTCATTGGCTGGAGGTGCACCATCGGGTGTTGTTGGGGGGTCTCCGGCCGCTGC
TTTTTCACCCAGTCCTTGGGTCTCGGAGGCTGACGGTCTCGCCGGCCTCATCCTCCGGGCCGTGGCCGAGTCCCAGCTGC
CGAGCCTTCACGTGCTGCATAGTCTGCCGTCCGACATGGCCGTCAGCCTCAAGGAACACGCCCAAGCCCGCTTCCTCGAT
CTGGTGCCGACGCGAAAGCAGCCGCTGCGGGACGCGCAGCACGTCTGTGTCGCCACCGGCTTCCTCGATGTCGTCCGCAC
CATCATGCTCAGCCAGCAGCTGCAGCAGAAACGCCAGAAGCAGAGACCGAGGTCGCAGCCACCAGCACCACCACCGCTGC
TGCTCTCGCCGGCCATCCAGTCGGCCGCTGGCCTGCCCGCGCTCGATTCTGCCGTCGTCGACAAGCTCGGCGAGCTGTGG
TGTTTGCTGCAGGAACACAAAACGTCGACGGCAGCCGCCATGGCCACCCGACAGAGCATCATCCAGGACTGGCTGCCGGC
CCTGCTGTCGCTAGTCCTGCTACACCTACCGAGTCGAGGGCTGACGACGGCTGATGGCCTGGGCCCGTCGCTACCGCGGA
CCAGCCGCGACCTGGACCAGGAGACGGTCAGCGCGGGCGCCTGCATCGTGCTGGCGAGTCTGTGCATCGATATCGTCCCG
CTGGCCGACGATCCGGCCGACGGCAACAGCAGCGGTCGTCTTGCCCTGCAGACCCGCCTGTTCGACACGGCCCTTCTGCT
AGCCGACGGGCTGTCAGACGAGACGCGCCAGAGCTGCGTGCGCACGCTGCGGGACGTGTCGGCGAGCGTGGCTGTCCCCA
ACACCGTCGGGGCCGGCGACCTGTCGCCCGCGATGGCGTATCTGCTGTCCAGTCCGGCATCGGCGTCCATCTACTACCCG
CGGCTGTATCTCGAACGGATGCCGGCCATGTTTGGACGACCAGGCCCACAGCAGCAGCAGCAGAGTGGAACGTCTAGCCA
GCCAACCACGGGAGCCGTGCGGCGCTTGGCCGGCTTTGCTGCACCGCCTGAACGCAGCCGACGGGTCCGATTCGGCCTCA
AGACTTGGGACGCTGTGTCCGATCCGAGTCCAGCCGTGCAGGACAACGACACGGCCGTGAACCTGTGGCTGTTGGAGGCC
ACCAAGGTCGTCCGCCAGCGACGGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62