GenePrediction:GLEAN_309 Details

Name: GLEAN_309
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:961846..963203 (+ strand)
Length: 1358
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:961846..962363 (+ strand)
Length: 518
Type: CDS
Source: GLEAN
Position: GCSC_167:962429..963203 (+ strand)
Length: 775
>GLEAN_309 class=GenePrediction position=GCSC_167:961846..963203 (+ strand)
ATGAAGGGCTACACCCAACTGGCAACAGCCACGCTCGTGGCTGCAGTCAGCTTCACCACTCCGGCCGCAGCAGCTGGCCG
TCGGAGCGCTTTCCGTTTCCGCAACGCCGAGCAGAGCTGGCAGCCAGCACACGAGACGGCTACGCCAGCCTCTGCCGCCA
CTCACCTGGATTACGTGCCACATGCAGCCCTGTATGACGGCGACAGCCGCGCCTTCATGAACAACGTTCCGCTCAGAGAC
TCTGTACCGCCAGCACCGACGACTGCCCCGACGTCGCCCTTTGACCACACCGGCCGTCTCCTTGCTCGCGCCAATTCGCT
GGATACCTGTGGCTTTGTCGATGCCGAATTTACCAGCCCCATCTACTGCAATGCAAACTACGAGTGTGTCGTCAACTCGA
ACAATTTTGTCATCGGCTGCTGTCCGTCCTCGTCTTCCAGCTGCCCCGTCCAGACCGCCTGTGTCGCTAAGACTGCTGTA
TCCCTGACCAACAGCGTGAACTCATACATCCTCACATGGTTTGTCCCACCCTCTCTTTCTGCCCGCTCCCTCCGCCCACT
CGTTCCATGACTGACCTTTTCAGCTCGGACGTTGCAAGTCCTGAATGCGTCACCTACGCATATACTGGCGCAGACTACTA
CGGCTACAATGCATATGGTTGTGCCACGGCTTCCGGCAAGAAGCCGATCGAATACCACGCCTCAGACTCTTCATCGTCGT
TCTCGTCGTCCATAACCGCCACCACGTCCGCTACAACCTCTAGCACGTCCGCTACAACCTCCAGCTCGTCTGCTGCCAGC
ACTACGGCCAGCAGTAACAGCAGCAAGAGCAGCAACCATGCCGGTGCCATCGCCGGTGGTGTGGTCGGCGGCATTGCCGG
TCTTGCCATCATCGCCCTTGCAGGCTTCTTCTTCTACCGCCACAGCCAGAAGAAGAAGGCCAATCTCGGCGGCCCAGGCA
CTCCTGGCGTCGCTCCCGGAGGCCAGCCGCCCTATGGAAATGATCCTCCGCCGCAGCAGGCGCAGTATTACCCACCCAAT
CCCCAATCGCCACAGCAGTTTGGCTACGGGTACGTCCCAGTGGCCACTGGTGCCGCTGCTGGGGCTGCTGTTGCCGGGGC
TGCATACACGCACAATAACGAGCCTCACGCTGCGTATGGTGTCGCGCAATCGACATCGCCGCTGTCGGCTGGCGCCCCGT
CGTCTTCTACGCCCGGCACGCTACACGAGCCCGCCGCTCCATATCAATCGCCGACACCAGCACATGGTATGGGCTTCCAG
AGCGGCCCCGTACCGACATATGATGTTCCCGAGCTGTCGACGGAGCGGCCAGATAGCGAGCTGCGGGAGTTGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62