GenePrediction:GLEAN_30 Details

Name: GLEAN_30
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:210304..211422 (+ strand)
Length: 1119
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:210304..210306 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_179:210408..210632 (+ strand)
Length: 225
Type: CDS
Source: GLEAN
Position: GCSC_179:210769..211422 (+ strand)
Length: 654
>GLEAN_30 class=GenePrediction position=GCSC_179:210304..211422 (+ strand)
ATGGTGTGTATCCGCAGTCTGGGGGCTGTCCGGCACTGCTGATCCGGCCTGGCAGGATGTGGTGGCCAGTTGAAGTTGCC
ACGGGCTAATGCTCTGCTTTCCAGACGTCGATAGGAACTGGCTACGATCTTGCCAACTCCATCTTCTCGCCCGACGGCCG
CAACTTCCAGGTGGAATATGCCGTCAAGGCGGTCGAGAACGGCGGCACGTCAGTCGGCATTCGCTGCCGTGACGGTGTCG
TGCTGGCGGTCGAGAAGGTTGTGGCGTCCAAGCTGCTGAAGCCGGGTGCCAACAAGCGCATCGCCACGATCGACCGTCAT
CTAGGCATTGTGCGTTCTTTCCCCTCTTTTTCCTTTTTGCCTTGTCTGCTCTTCGTAGCGCCTGTCTTGTTACTGGCCTG
GTTTCGTTTTGTTGGTCTTGATGCTTGCCTTCTCCTACCTGCTGACACGTCCGTCCTCGCCACAGGCCTACTCCGGCATG
ACGCCCGATGGCCGGCAATTTGTGGGCCGGGCCCGCGACGAGGCGCGCAGCTGGCGCGAGACGTTCAAGACGCCCATCGG
CACGGCCGAGCTGGCGTCGCGTGTGGGCGGCTTTTTGCAGGCATACACGCTCTACCAGTCGGTGCGGCCGTTTGGCATCA
CGGCGATCCTGGCCGGCGTCGACAGCGATCGCGACATGCCGGTGGATGGCGAGGTCGGCCAGGGGCCACAAGTGGGTGCC
GGCGGGCGCCTTGCCGGCAAGAAGCACGGCGGACCGGCGCTGTACATGCTGGAGCCGTCCGGGCTGTACTGGGGCTACTA
CGGAGCCGCGACCGGCAAGGGCCGACAGGCAGCCAAGGCCGAGCTGGAGAAGCTCGACCTGGCCGGCGAGGGCATCTCGC
TCGAGCAGGGCGTGCGTGAGGCTGCCCGCATCATCTACGTGGCACACGACGACAACAAGGACAAGGACTTTGAGCTGGAG
ATGACGTGGATCAGCACGGCCGACGGCCCGACGGCCGGCCGCCACGAGGAGGTGCCGCGGGCGCTGCTGCAGGAGGCCGA
GCGCCTGGCCAAGAAGAGCCTCGAGAGCGACGACGACGATGACGACGACAAGAAGGACGACGACAAGATGGAGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62