GenePrediction:GLEAN_3100 Details

Name: GLEAN_3100
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:192866..194710 (+ strand)
Length: 1845
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:192866..193034 (+ strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_161:193100..193127 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_161:193186..194710 (+ strand)
Length: 1525
>GLEAN_3100 class=GenePrediction position=GCSC_161:192866..194710 (+ strand)
ATGGCCAACACTCCCCACGGCGGTGTCCTCAAGGACCTTCTAGCACGCGATGCCCCTCGCCATAACCAGCTGGCTGCCGA
GGCCGAGACCCTGCCGTCTCTCCTCCTCAGCGAGCGTCAGCTGTGTGATCTCGAGCTGCTCCTCACCGGTGGCTTCTCTC
CACTCGAGGGTATGTTTTGCGTAATGTGTTGCCAGTGGTTGGACTGCGGATGAGTGCCTAACTAACACGAACAGGCTTCA
TGAACGAGAAGGACTACAACGGGTAGGAGACAGCTCTGCTACCAATACCAATTCAACCTTTCCATTCGCTAATCGTGCAG
TGTTGTCAAGTCCAACCGGCTCGCTAATGGCGCGCTCTTCAGCATGCCCATCACGCTCGACGCCAGCCAGGCGACAATCG
ACGAGACGGGCATCAAGACAGGCGCGCGGATCACGCTGCGCGACCTGCGTGACGACCGCAACCTGGCCATTCTCACGGTC
ACGGACGTGTATCGGCCCGACAAAGCGCTCGAGGCCAAGGAGGTCTTTGGCGGCGACCCGGAACACCCGGCCGTCAAGTA
CCTGTTCGAGACGGCGGCCGAGTTTTACGTCGGCGGCACGCTCGAGGCAGTCAACCGGCTGCAGCACTACGACTTTGTCG
ACCTGCGCTACACGCCGGCCGAGCTGCGGTCGCACTTTGACAAGCTCGGCTGGACCCGGGTGGTGGCCTTCCAGACACGC
AACCCGATGCACCGGGCCCATCGCGAGCTGACGGTGCGGGCAGCTCGATCGCAGCATGCCAACGTGCTGATTCATCCGGT
TGTTGGGCTGACTAAGCCGGGAGATATTGACCACTTCACGCGCGTGCGCGTGTACAAGGCGCTGCTGCCGCGCTACCCCA
ACGGCATGGCCGTGCTGGGTCTGCTGCCGCTGGCGATGCGCATGGGCGGTCCGCGCGAGGCCATCTGGCACGCCATTATC
CGGAAGAACCACGGGGCCACGCACTTTATCGTCGGCCGCGACCACGCCGGACCGGGCAAGAACAGCAAGGGCGTGGACTT
TTACGGTCCCTACGACGCCCAGCACGCGGTCGAGCAGTACCGTGACGAGCTCGGCATCGAGGTCGTGCCCTTCCAGATGA
TGACATACCTGCCCGACCGCGACGAATACGCACCCGTCGACGAGGTGCCGCAGGGCGTGCGCACGCTCAACATCTCGGGC
ACTGAGCTGCGGTCGCGCCTGCGCAGCGGCCGCGAGATCCCCGAGTGGTTCTCGTACCCCGAGGTGGTGTCTGTGCTTTT
TGAGTCGCATCCGCCGCGTGCCCGCCAGGGCTTCACCGTCTTCCTGACCGGCTACACCAACAGCGGCAAGGACCAGGTGG
CCCGCGCCCTGCAGCTGACCCTCAACCAGCAGGGCGGCCGCTCCGTCTCCATGCTGCTGGGCGAGACCGTCCGCGGTGAG
CTGTCGTCTGAGCTCGGCTTCAGCCGGGAGGATCGTGCCCGCAATGTCGGCCGCATCGCCTTTGTCGCCAGTGAGCTGAC
CCGCTCCGGTGCCGCTGTCATTGCCGCCCCCATCGCCCCGTACGCCGACGCCCGCCAGCACGCCCGCGAGCTGGTCGAGA
AGCACGGCGACTTCTACCTCATCCACGTCGCTACCTCGCTCGAGCACTGCGAGCGCACCGACAAGCGCGGCATCTACGCC
CGCGCCCGTCGTGGCGAGATCAAGGGCTTCACCGGCGTCGACGACCCGTACGAGAGCCCGGACAAGGTCGACCTGGTCGT
CGACCTGGAGAAGCAGTCCGTGCGCGCCGTCGTCCACCAGATCGTCCTGCTGCTGGAGAGCCAGGGCCTGCTAGACCGGT
TTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62