GenePrediction:GLEAN_3101 Details

Name: GLEAN_3101
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:196383..199003 (+ strand)
Length: 2621
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:196383..198355 (+ strand)
Length: 1973
Type: CDS
Source: GLEAN
Position: GCSC_161:198458..198546 (+ strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_161:198600..198663 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_161:198727..199003 (+ strand)
Length: 277
>GLEAN_3101 class=GenePrediction position=GCSC_161:196383..199003 (+ strand)
ATGTCGCCGACACCTCCAGACCGGCTCCTGGCCCGGTCTATATCCCACGGTGGCATTGCCGGTGCTGTAGTCGGGCCTGT
GGTCGGTGTTTTCTTACTTCTCCTGGCATTGCCGTTTATCTTGCGGGCGCTTCGAAATGCTCGCCAGGGCCCTTCCGATG
CTCCGCATATGGACATGATCGGCCCTCCGGCAGTTGAACCCGGCCCGGCAGGCCAGTCTCCGTTTGCATACACTCAGTCC
TTCCCTCCGACCGGCTCTCCCACTTACGACAACAACTCATTCGACGATGGCAAAGCTCCTGTATCCTACTCTCCGTCGAC
GGCAGCTTCGGGGTCTGCAGCTGGGAATTCGGCCGGAGCAGCTCCCCCACTCGGAAGCTCTGTGGCCAATACCAACGTCC
CGCCCCTTGCGGCCGATCAGCCTTCCGTCTTTCCGACAGCACCGTATCCTCCTCCGAACCCGTTGGACCAACGCAGCCCG
ACAGAGCGGTCAACGTCGTCGTCTTTGACGCAAACCCTCACGTCCTTCTTCCGCAACAACACGCAGTCTACGCAGGTTTC
AGCCTCCCGCGGACCTGGCGACATGTCACGGTCTCCGGTGGAGGATGGCTTTGGCGGCTACAACCCCGACAACGGCCAGA
TGTGGACGGGTGGTCCTTCTGGTCCCATGAATTTCCAGCAGATGCCTCCCGTTGGTTACCCTCAAGCCGGCTATCCTGGG
CCCGGCTATCCAGCTCCTGTCTATCCGCCAGGGAACTATTCAAATGCACCGTATCCCGGCTATCCTGGGCCCGGGTATCC
AGTGGGCGGCTATCCTGGGCCTGGATATCCCGGAGCTGGCTACCCGCAAGACGGATACCCGGCAGAACAATATCCGGGCG
CAGTTACTGGCATGTACGGAGCCGAAGAGCAGCATCTCACCGGCGCTTCGGCAGAATACTACTCTGGCGCTCCGTTATCA
CCACCATCGGACGCCGGCTCCGTGGCCGAGCGAGCGCGCGATAGCCCACCTCCGTCGGACCATGCGCTCTCCAGTCTCAT
CTCCTTGTCAGCAGCTGCAGCGGCGGCGGCCTTGGTGCCATCTGGTTTAAAAGATCCGAAGCTGCAGGCTATCCGCACCG
ACAGCAGGCCTTCCGGAGCCGACTTTTCGCCACTGAGTCCGACATCACCTCCCGAGGTAAGCGATACCGCCGACACGTCC
CAGAGTCCTGCAATTGGGGCTGGGGCTGGGGAAGGCGAGAGGGAAAAGACAGTGGCTCGTTCCTCCCCACCTCCCCAGGC
TTCCAAGGCAGCGCTCACGCCTGAGCCAATGCCAGAGTACACGCCTCTCTCGCCCTTTAATCGACCGCTAGTTCCAAGTC
CTCGGCTTCCGGCGCCGGGCACAGTCAACCCTCGGGATGTTTGGGCTCCGGCTACGGAAGACGAGCGCTTTGTTCATGTG
ACCGCCGAACTCGACCGCTACGAGCAATCGCCTCCGCCGCTGGTTCTGTCCGCCGAAGAGAGCGCCGCAAGTTACGCGGC
CGCCGAACAGCAGGCGCTTTCTCCGCAGCTGACGGTGACTCCTCCGGATGCGAAGGTCAGCAGTCCTGCAGACGGTGTTT
CCGAATATGAGGACGAAGTAGAGCAAGAAGAGGTTGAAAACATCAAGATGGAGGCACAGTACGATGATGGGAACGGCGGG
TTTAGCATGGCAAACTTGGAGGCGCATACGGCCAGCCAGGGCAACTACCTGAATGCCGGTGTACTGTCGCCGGGCGAGGT
CAAGACGGACCCGTTTTACATGGCCCAACAGGCCAACGATGCCGTCTCGCTTGGTCCAGATGGTAGCCATTTGATGGCAG
CCGGTTCATACATGCCGACGACGTCTGCCCCTCTGCAACACACGCCGTCCGGCATGGTCCTCAATATGCAGGCAACGATG
GCAACGATGGCATCCAGCTCTACGTCGCCTGGAGAGTCCTATCTCTATACACAGTGCGACTTGCAACATACAGCTCTCCC
TAACGGGCATATAATGGCACAAATGCCAGCGATGGCCCCAATCACACCGCCGCAACCGTCTACTCATCCATCCAGTTTTA
GCACACCGCTGGCCGTAGTGCAAGCTGACTTCAACTCGACATCGCCATTATCTAATTCGGGCTCAACACCTGGACAGGTT
TCCGGTAAGGACAGTCTTCGTCTTCCTTGGGTCGCTTTTCTAACAGGTTAATAGCAGCGTCCCCGCACGCGTTCAAATGC
GAAGAATGTGGTCGTATGTTTGACCAGGTCCACAAGCTGAAGTAAGTGGCCTTGTCTCCGTCGGGCATGCGTGGTTGCAA
GCGAAGCACTAACAGGGACATTAGTCATCATAAGCGGTACCACGAGCGGCCACACGAGTGCGTTGTTACCGGCTGTGGCA
AGCGATTTGGCACCAAGACGCATCTGGACCGGCACATCAACGACAAGCACAGCAAGAGCCGAAAGTATCACTGCACGGAA
GAAGGCTGCCCATACTCGGTGCCTGGCGGCAAGTCGTTTCCGCGCAAAGACAACTGGCGGCGACACATGGTCAACAAGCA
CAGCGTGCAGCCAGATCACGATCCGATTGAGGTGGTGGACCAACCTATGATGGGCGTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62