GenePrediction:GLEAN_3110 Details

Name: GLEAN_3110
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:261853..262204 (+ strand)
Length: 352
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:261853..262033 (+ strand)
Length: 181
Type: CDS
Source: GLEAN
Position: GCSC_161:262089..262204 (+ strand)
Length: 116
>GLEAN_3110 class=GenePrediction position=GCSC_161:261853..262204 (+ strand)
ATGATCACGCACTTCCTTACCGACGTCAACACGCGCTTCAACCCGTTCTCGCCGCGGGCCAAGGCGGCACGGCTGTTCCT
CTCACTGCTGCCGCCACGGGCTCGACAACAGGGTCTCAACGTGACGACACAGCTGCTCGCACGCACTTCGACGGAGCCGA
GCCTCCTGCACGTGCGCTTCAGTGCGTTCCTGTTCCTGTTTGTTCATGTTCTTTGATCTCTCTAACGCACACCCAGAGGA
CGGCAAGGAGATGCAGCTGGACTGCGAGGCCATGGGCATCAAGCGGGTCGTCGAGGAGGTGGACCGACACTCGCGGGCGC
TGCAGAAGCAGGCCGACCTGGCCGACGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62