GenePrediction:GLEAN_3111 Details

Name: GLEAN_3111
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:269932..273965 (+ strand)
Length: 4034
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:269932..269995 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_161:270067..270200 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_161:270312..270752 (+ strand)
Length: 441
Type: CDS
Source: GLEAN
Position: GCSC_161:270817..270883 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_161:270942..272517 (+ strand)
Length: 1576
Type: CDS
Source: GLEAN
Position: GCSC_161:272573..273965 (+ strand)
Length: 1393
>GLEAN_3111 class=GenePrediction position=GCSC_161:269932..273965 (+ strand)
ATGGGCAATGTCACCAGCCACCCTGACGAGGGCGGCGCCCTCTTTCTTCGCGACCAGAACCGATGTAAGCGCTTGCTCCG
CTCGCCTAGACCGAGAAAAGGTTTCGCCAAGCTTGGCTCTCTGACCGCTGTCTAGTATCAATCTCGTCCCTGGTCATCGC
CTCCCAACAGCGAAACTCTTCAGTCATAATCACCCCCAATGCATTCCCTGCGACCAGACTCGCTGCCACCCGTTCACTAG
GCGAAAACTCCCCCGTGGAATACATACAGGTTCGCAAAGTCCCCACGTTCGACCACATGACATGCTTCCCATGCTCTGGC
AGTTGCTGCGCCTGCTGCCTTTACCGACCCTAACATGCTTACTGTTCTTGCTCTCCACAGGATCCCGACTCCTTGCTGTC
CTCTGCGCCACCCTCATTCCTGCTCAAGCTAACCAACGACGACGATCTCACCTTCACCTTTAATTTTGTCATTCGCCAGA
CTTCCGGCACGCCCTCGGCTGCTACTGCCGGCTCCTCTGCTCCCTTGTCCGCTGGCCAAGCTGCTGGCGCCGGCGCGGCC
GATGCGAATGGCAGCTCGGCTGTCGTTGATACCCAGATCTGCGGACTCACATTTGTCTACGCGTCATCGGGGCGCGAGGT
CGAAAACCTGGTCACCCGCGAGTTTCATGCCGACCCAAACCTCCACAAGAACTCAAACGTCAAACTGGTCGGCGACTATT
CCACCGGCGGCAGTTCTTCTGTCTCCTTTAAATGGACCTGGAAGTGGAAGCCGCCCAAGGTCGCTGAGGACAAGGGGTGC
GGCTGGCGACACTCCTGTAGCGTGTGTTCTGCTCAGACCTGTTCTTTCTCTCGCTTCCTCAGCATCTCCTGCTAACAAGG
CCCAGTTTGTCGAGTACGACTCGCGTGCGCATATGCTGCACACCTTGGCTAGCTTCTCCTTCTGGGTGGCCAGTATGCAA
GCCCCATGTCCTGTATCACGGTCTTGTCGCCCTCTAACTGTTTCTTTTAGACGCAAACCCCTTCTTCAGCCATCCCAGCT
CTCCTGTGCCCTTTCTGCTCAGCGCTGCCCCTCCCAAAATACGGGTGGCCTCTGCCCAGTCGGTCGAGTCTCGCTTCAGC
AATACCGAATTCGATGAGCCTAGCTCGCCCCGCGTCGGCCTTCTGGAGCCGGGAACCATTGTCGCTGCTCTGCCGCCACT
GCCACCGCCAACTGCTTCCGCCGTTCCGGCTGAACCTGTCAGAGTCGACATAACATGTCCGCGCCCGGGCGACGACATGA
CAGCAACTGATGACGGACCCGTTTTCCGTGCCACCATCAAGTCATTGGAGCAGAAGACGGGCAACATCCGCATGCAGATG
AAGAAAGTCATCAAAAAAGCCGAGCATGCCCACCAAACCCAGGCAGAGGCTAACGATGCCTTTGCTGGCTTTGTCGACGC
CCTAAAAGAGACGTCATCGACAAACGCAAATGCTGTTCAGCCGGCCCTTGACCACTACTTTAACAAGATTGCCCGCGAAA
TTCTCTCGTATGAGCGCCAAAATGCGTTCAACCTGCAGCGCATTGTCATTGATCCCCTCAACCGGCTGTACACATGGGAT
ATCAAGCAGGCCGAGGCCAAGAGGCGCGAGTTCGAGGAGGAGAGCAAGGACTACTATTCTTACGTCGGCCGCTACCTGGG
CCAACGTCACGACTCAGTCAAGGCTAAGAAACTAGCCGAGAGCGACACAAAGTACCAGACAAAACGCCGCAATTTTGAGC
TCAAGCGCTTCGACTACTCCTCCTTTATGCAGGACCTGTCAGGCGGGCGCAAAGAACAGGAGATCCTCTCCCACCTCACG
CGCTTTGCCGACACGCAAGCCTCAGCCTTTCTCGGCGCCGCCAAGAAAGTGGATGCTCTCCTCCCCCAGCTAGAAGCTCT
CTCCAGCGAAGTGCAGCTTGCCGACAAGGAGTACCAGTACCAGCGCCGCGAACGGGAGGAAAAGCGCCGCGTCCTCGAGA
AGAGCAACATGTCTTACGTAGAGCCTGACTCTTCCTCGACGACTCATGCAAACGGCTTCACTGTCAGTTCTTTTGCTTCT
GCTGCCGCCGCTGCTGCTGCAAATGTCGGTGCCAGCATCAGCGCAAGCGCTGGCATCAGCACCAGCAGCAGCACTGGCAC
TAGTATTGGCAATGGATATGGCAATAGTGCTAGCAATAGCGCTGGCGCAGGCACAGGCACAGGCACAGGCACAGGCACTG
GCACTGGCACTGGCACCAGCACGAGTCACTCCTCGGACACGGAGCTGGGACGGGCTGATAGTATGGGCTCACAACTGCGC
ACAGTTAGCACAGGCGGGACGATCGGCAACGCTGTCGATCTGTCTCGGTCACCTGGGACCGTTGGCACCCAGCATCTTGC
CGTAGGCAGCCCGCCGCAAGCGTCCAAGTTCAAGGGCTTCCGAGATCTGGAGGAGCGCGACCCAGCCCAAAATGCGCTCT
TAGAGAAGAACACGACCCTGCGAAAGGAGGGCCTCTTGTGGGCTCTCAACCGACCAGGCAACCACGTCGACCCACGGACT
GCCCTAAACAAGCAGGGTTGGCACAAGTACGTTTTTCATAGCCCGGGTGTTGTGTTTGAATCTTCATTACTGACTCCTCA
GGTTCTGGATCGTTCTCGACCAGGGCAAGCTTTCCGAGTACAGCAACTGGAAACAGAGGCTGGACTTGCACATGGACCCC
ATCGACCTTCGCATGGCTTCGGTTCGTGAAGCAAGAAACGCCGAGCGGCGTTTTTGCTTCGAGGTAATCACGCCTCAGTT
CAAGCGCGTGTATCAGGCCACGTCTGAGGAGGACATGAACAGCTGGATCACGTCCATCAACAACGCCTTGCAGAGTGCCG
TGGAGGGTCGTGGTGTTCGGGAGCGGCGAGCACCGTCCATCTCCCCTTCTACGGGTTCGGCTGCCTTCCCGGGTCGTGAC
ATTGGCTCCATCCTGACTGGAAAGAGCATATCTCTCTCGCACGGGCACCGGAACGCTGGAGGAGGCATAGGACAGTCGAT
GTCCGGCAACACAGGCATTCCAAGCCGGCGCACTACCGTGGGAAGCCGGCCGAGCACTCAGCGATCTAGCAGCGGCAGTT
TCGAAGAGAGGCCGGATAAGCTCTTGCAGATGTTACGCGACAGCGACCAGGGCAACTGCTGGTGCGCAGATTGTGGCTCG
GGGTCCAAAGTGGAGTGGGTATCGATTAATCTGGCCATCATCGTGTGCATCGAGTGCAGCGGCATCCACCGGTCGCTGGG
CACACACATCAGCAAAGTGCGGTCGCTGACTCTGGACATTACGTCTTTCACGCCCGATATTGTGGAACTACTGCTGCTGG
TGGGCAATCGGGTTGCGAACATGGTGTGGGAGACAAGGCTCGACTTGGCACTCAAGCCGACAGCACAGGCAAACCGTGAG
CAACGGCTTCGGTTCATCACGAGAAAGTATGTTGACCGGGCATTTGTGGAACCAATTTCAGCGACGCTGTCGCGGTACCC
TACGGCGGACGAGACGCTGCTGGCTGCCATCAAGAAGAATGACATCCAGCAGGTCATATATGCACTGGCGCTCAAGGCAA
ACCCGAATGCGACAGACTTATCCCGTGGGACCCCGGCCGTGTTTCTGGCGCTGGCTGCAGCCGATCCGGCTCTGCCTTCA
GGCATGTCGGGGCCGCTGCCATCGCCAGGACCAGTGGCAGACACCAGGCTGGTCCCGTTCCCGATAGCCGAACTGCTGTT
GCAGAACGGAGCCGAGATTCCGTCGACGAAGCCGGCAATCCCGCTGGGCCGAAGCGCCCAGCAGTACGTCGAGGCCAAGC
GGGTGCGGACAGCCGGGCTGAATGCGAGTGGTCCGAGTGCCGCTGTGTACGAATCTGTGACTGCGATCTCGTCATCGTCT
CCGTCTTCTGCGGCGGTCGCAATGGACCGGCTGGCTCGTGAGAAGGAGGCGAGGCTGCAGAAGCGGGTGAGCGCTGGCGG
GCGGCTGGCTAGAAGTCCAATCCCCGAGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62