GenePrediction:GLEAN_3113 Details

Name: GLEAN_3113
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:278185..280082 (+ strand)
Length: 1898
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:278185..278250 (+ strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_161:278392..279197 (+ strand)
Length: 806
Type: CDS
Source: GLEAN
Position: GCSC_161:279260..280082 (+ strand)
Length: 823
>GLEAN_3113 class=GenePrediction position=GCSC_161:278185..280082 (+ strand)
ATGTGTGCACGTGACATCCCACTGCTGGAGAGCAGGAGGGGAGAAGATTTGGATAGAGACTGCATCGTAAACGGGAAAAA
ATTCACATAGGCTCTCGCATCCGCCACCAGCACGATAGTCAGCGCCACCGAGCACCGACTCTGCCTCATCTCACCACGCA
GCGGCTGCCGTAGCATGTCGATCGGACCGCACGGCTCTTCTTGGTAGGACCAGAGCAAAGAACGGCGCACCGAACAAAAC
ATCGGCAAAGAAGCCGACCCGGAACCGGAATCCGGACCAGACGACATCGATTCCCTGCCACAACCGCACTCCGTCGGCAG
CGACAGCACGTGGTTTCCGTACGGAAACGATCCCGTCAGCAGTCTTCTCGAGGCGACCTCGCGGCGGCTCAAGCACGTGG
CCATCATGGCAGCACCCACCACATCCTCGCCTGCTGCAGCGGCAGCAGCAACCACCCAGACGTCGGTGACCGGGCGGCCG
CGCCTCGTCTTCGTCGACGGCACATTTGCCGAGCTCGTGCAGGAGCTGGCCGACTACCTCCACGTCGGCGAGGCGGTCGA
GCCGCTGTTGGCCCAGGAGAAGAACGAGCAGGCGCTCGCCAAGGTGGTGGAAGCGTCGGCAGCCCTCAGTGCGGTGCCCG
AGAAGGAGTTCACCGGGGCCTACAACCTGCTGATCCACCTGGTCGTCAATGAGTCCAAGGACGCGAGCCCGTACCTGCGC
ACCATCTGCCAGAACCTGCTGCAGCCGGTGACGTCGTCGCCGGTCAACGGCCCGGCACTCGCGCTCAACGCGCTGCAGGC
TATCTTCAACCTGCTCGCGCCGACAAATGGACTGCGGTACAACGTGCTGCTGTCGATCCTGCGGTTCGCTCGCGTCAACG
GCTTCTACGACAACCTGAAGCCGACGCTGCCGAACCTGCCGCGCTGGCTGCAAGAGTGGGACGTGGACGAGGAGGCCCAG
CGCAAGATTTACCTGGAGATTGCGACGATTGCGTCAGAGGGAGGGGAAGACGAGTGAGTTTTTTGACCTTTTCTTTTTCT
GTTTTTTTTTGCTCTTCTTTCTCTAACCCTCCCAGGGAAGCATACCAGTACCTGCTCAAGGTGTTGCGGACGTTTGACGC
GGCGGACGAGGCAGCGATCAAGTCGGACGAGGCAGCGGCGCTGTCGGTGCGAGCAGTGCGGATGGCGCTGCTGTCGAGCA
CGCACTTTGACTTCCAGGACCTGCGGGTGCTGCCGACGGTGCAGGCGCTGGCAGACTCGCACGCGGCGTACGCGCAGCTG
CTGGACATCTTTGCCGAGCAGGATCTGGAGGACTACCGCGACTTCTGCGAGGAGCACGACGGCTGGGTCGAGCAGGAGGG
CATGGACGACGGCCGGCTACAGCGCAAGATGCGGCTGCTGACGTTTACGAGTCTGGCGGCAGCGAGCACGCAGAGCCGCG
AGATCGAGTACGGACGCATCGCCAAGGCGCTGCAGATCCCGGTCGAGGACGTCGAGGTCTGGGCCATTGACGTGATCCGC
GCCGGCCTGGTCGAGGGCAAGATGTCGCAGCAGAAGCGCCTCTTCCTCGTCCACCGGACCACGTACCGCGTCTTTGGCGA
GAAGCAGTGGCGTGAGCTCGGCACCCGCCTGGACCAGTGGCGCGGCAGCCTGCGCAGCGTCCTCGCCGTCTTGCGTCGTC
AGCAGGCCGAGGCCGACGCCCAGCGCGAGCGCGAGGCCCAGGAGCTGGAGCGCAAGCTCGCCGGTGCCAGCCTCGGTGCT
GGCGGCGACCCGTCTGCCACCGGTGCCGGCGGTGCCAGCAGCCAGCGACGAGGCGGCGGTATCGGCATGGACGGCAAGCC
GCGTCAGCCCTTCCAGCAGCGCCAGCACATGCCCCATCGCAACGAGAACGACGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62