GenePrediction:GLEAN_3114 Details

Name: GLEAN_3114
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:280476..281637 (+ strand)
Length: 1162
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:280476..280809 (+ strand)
Length: 334
Type: CDS
Source: GLEAN
Position: GCSC_161:280991..281637 (+ strand)
Length: 647
>GLEAN_3114 class=GenePrediction position=GCSC_161:280476..281637 (+ strand)
ATGGCCTCCTCGCTCTCCCGTGCGTTCCTGCGCCGCCAGCTGGCAGCAGCTCCTGCAGCTGGCCGAATGCTCCTGCCACG
TGTGTCGGGGACTGCTGCCCAGGCACGTGCCGGACGGTTGGCTCATGCCACGTCCTCGTCGTCCGATACGGCGTCGTGCC
TCCATCGACTGTCTGCACGTCGCTTCTACTCCTCGAACAGCTCCAGCTCTCCGCCGCCGCCGCCACCGCCTCCTCCGCCG
TCGAGCCCCAAGCAGACGATCAAGTTCTGGCCGTTTATCGTCGTCATCGCCCTCGGATTTGGTGGCTACGCCGTGTTGGT
CAACCAACGAATGAGTACGTGATTGGGTAGAGGTTGAGGCTTTTACGCTGTGTCCGCTCTTTTCTACTCCGTACACCTCT
GCAGCTCTTCCTCTTTCTTTATCCCCTCTTCTTTTCTCCTCGTCTCTCCTCACCCTCGTCCCTCCTCATCTTCGTCCCTC
ATCCCTCATCCCTCCTCCTCGTCTAACGTCCTCAGACATGCCGGAAGACCAGAAACGTGGCTCGTCCGAGCCCAAGCCGA
CCTTCTCCGAGGACGACGTGACGGTCGTGTTCGTGCTCGGTGGCCCCGGTGCCGGCAAGGGCACGCAGTGTGCCCGGCTC
GTGCAGACGTACGGCTTCGCCCACCTCTCGGCTGGCGACCTGCTGCGCGCCGAGCAAGACCGGCCCGGATCCGAGTTTGG
CCAGCTGATCAAGGACTACATCCGTGACGGTCTGATCGTGCCGATGGAGGTGACGGTCAAGCTGCTGGAGAACGCGATGA
AGGCATACGTGGCCCAGAACCCGGACCGGCGCCGGCTCTTCCTCGTCGACGGCTTTCCCCGCAAGATGGACCAGGCCGTC
GCCTTTGAGTCGACCGTGTGTCGTGCCAAGCTCGTGCTCTTCTACGACTGCCCCGAGTCCGAGCTGGAGCGCCGCCTGCT
CGAGCGCGGCAAGACGTCCGGCCGCTCCGACGACAACGCTGCCTCCATCCGGAAGCGCTTCCACACCTTTGTCGACACCA
GCATGCCCGTCGTCGATGCCTACTCCCAGCAGGGCCGCGTCGTCAAGATCGACGCCACCGCTACCCCCGACGCCGTCTTC
CGCGACACCCAGGCCAAGCTCGCCACCCGCCTGTCCTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62