GenePrediction:GLEAN_3115 Details

Name: GLEAN_3115
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:286560..288214 (+ strand)
Length: 1655
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:286560..287086 (+ strand)
Length: 527
Type: CDS
Source: GLEAN
Position: GCSC_161:287146..288132 (+ strand)
Length: 987
Type: CDS
Source: GLEAN
Position: GCSC_161:288184..288214 (+ strand)
Length: 31
>GLEAN_3115 class=GenePrediction position=GCSC_161:286560..288214 (+ strand)
ATGGCAGACAAGTACGACCACGACGACATCGAGTCCGGTTCGGATTCAGGCCCGGATTCGCCCATACTGGAGCCACAGGA
CGTGTCGGACGGCGATATCGACGAGAAGCCGCTGAAGTCGGCGCTGAAGAAGGGCGGAGAGGTGGCAGTGGAGCCGGCAG
TGGTGAAGCCGCCGCTGCCACCACAGACGGATCCCAAGGATCTGGACGTGAGCAAGCTGACGCCGCTGACGCCAGAGATT
ATCGCGCGGCAAGCGACGATCAACATCGGGACGATCGGCCATGTGGCGCACGGCAAGTCGACGGTGGTCAAGGCGATTTC
GGGTGTGCAGACGATTCGGTTCAAGAACGAGCTGATCCGCAACATCACGATTAAGCTGGGCTATGCCAATGCCAAGATCT
ACAAGTGCGACAACAAGGCGTGTCCACGGCCGACGTGCTACCGCAGCTACAAGAGCGACAAGGAGGTGGACCCGCCGTGT
GAGCGCGAGGGCTGTGGGGGGACGTACCGTCTGCTGCGTCACGTCTCGTGGGTTTTCTTGTTTGTCTTTGCGTTTTGGAT
CGATTCCATCTGTGCTAACCAGACAGGTTTGTCGACTGCCCCGGCCACGATATCCTGATGAGCACGATGCTGTCGGGCGC
CGCAGTGATGGACGGGGCGCTACTTCTGATCGCAGGCAACGAGACGTGTCCGCAGCCACAGACGTCGGAGCATCTGGCGG
CGATCCAGATCATGAACCTGGACAAGGTGGTGATCCTGCAGAACAAGGTAGACCTGATGCGCGAGGAGACGGCGCAGCAG
CACTACGAGTCGATTCTCAAGTTCATCCGCGGCACGGTGGCGGCCAAGTCGCCGATCGTGCCGATCTCGGCGCAGCTCAA
GATCAACATTGACGCCGTGCTGGACTGCCTCGTCAACACGATTCCAGTGCCGCCGCGCGACTTCTCGACGGACCCGCAGA
TGATTGTGATCCGCTCGTTCGACGTGAACAAGCCGGGTGCCGAGATCGAGGACCTCAAGGGCGGCGTGGCCGGCGGCAGC
ATTCTGCACGGCGTGATCAAGCTCGGCGACGAGATCGAGATCCGGCCCGGCCTGGTGACGCGCGACGAGGCCGGCAACCT
GCACTGCACGCCCATCTTCAGCCGCATCGTCTCGCTCAACTCCGAGTCCAACGACCTCAAGTACGCCGTGCCGGGCGGCC
TCATCGGCGTCGGCACCCACATCGACCCGACACTCTGCCGTGCCGATCGGCTGGTCGGCTTCGTGCTCGGCCTCAAGGGC
CGCCTGCCCGACATCTACAGCGAGATCGAGGTGAACTTTTACCTGCTGCGCCGCCTGCTGGGCGTGCGTACCGCCGACGG
CAAGCAGGCCAAGGTCGAGAAGCTGGCCAAGAACGAGGCCATCATGGTCAACATTGGCTCCACCTCGACCGGCGCCAAGG
TCGCCGCCATCAAGAACGATGCGGCCAAGCTGGTCCTGACCAGCCCCACCTGCACAAACATTGGCGAGAAGGTGGCACTG
AGCCGGCGCATCGAGAAGCACTGGCGGCTGATCGGCTGGGCCACCATCACGGCGTGAGTTTCTGTCCTGCCTTTCCTGTC
TAGGAATCTCTGCTAACGAAGCAGTGGCGTCACGCTCGAGCCGACGTTGCCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62