GenePrediction:GLEAN_3116 Details

Name: GLEAN_3116
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:290746..292849 (+ strand)
Length: 2104
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:290746..292596 (+ strand)
Length: 1851
Type: CDS
Source: GLEAN
Position: GCSC_161:292661..292849 (+ strand)
Length: 189
>GLEAN_3116 class=GenePrediction position=GCSC_161:290746..292849 (+ strand)
ATGTCTTTTAGCTTTGGCAGCCAGTCGACCGCTGGGTCGGCCACCCCGGCCACGACCACCACCAGCGGTACCCCTTCTTT
TTCCTTTGGCAACACCCCTTCCTTCTCCTTTGGCAACTCCTCTACACCGACATCTGGGCCCGGAGCAACTGCCAGCAAAC
CCGCAGCGACCGCAGGCAGCCTATTTGGAAATCTCGGTGCAACACCCACATCCCAGGCGGCCAAACCGGGTGGCTTGTTT
GGTGGTGGCAGTACCACCCCAGCTCCCAGTGGTGGTCTCTTTGGAGGTGCTGCCACAGGCTCCACGACTCCTTCGACCGG
CCTGAACTTTGGCTCGGCTGCCGCTGCGACCTCGGCCGGGACGGCGCCCAAAAGTCTCTTTGGTGCAACTACGGCCGGTG
CGAGCAGCACGCCGCTATTTGGCAGTGGAAGTGCCGCGGCACCTGGCATCGCGAACACGACCGCCCCGACAACAACCACT
GCTTCCGGCGGCCTGTTCTCGACTGCCGGCGCGACCGCAATGACGCCCGCAAAGCCGCTCTTCAGCGGCCTCGGCTCGAC
CACGCCTGCTGGTGCACCTCCCTTTACCAAGCCCGCAGGAGGGGCTCTGTTCGGCAGCGGTTCCTCAGCAGCGCCGGCAA
GCGGCGCCGGTTCTTCGGCTGGCGGTGGCCTGTTCGGTAGCCAGACTGCCAAGCCAAGCCTGTTTCCCTCCTCCACTCCC
GCCCAGCCGGCTGCAACGGCGCCCACTGCTGCCGGGTCACTCTTCTCCAACACCCCCACAACCGCAGCCAAACCGGCCGG
CAGCTTGTTCTCGTCCGCAGCTACGCCCACCACTACCACCCCGGCAGCAGCTTCCTCTACCCCCAGCCTGTTCTCGGGGG
CATCGGCTCCTGCTGCTTCTGGTAGCCTGTTTGGCGCGAAGCCCGCAACCACTGCTTCGACTACGGCTGCGCCATCTCTG
ACGCCCACGACTGCTACTCCTGCGAGCGGGCTGTTCGGTGGTGCCAAGCCCGCCTCCTCAACACCGGCATCAGCCACGGC
TGGAGGACTGTTCGGCGGACTGGGAGGAGCCTCGGCCACACCATCTACCACTGCACCGGCCGCGTCTGCTGCACCTGCTT
CTGCCAGCTTATTCGGCGTCAAGCCTGCTGCTGCCGCGACCACATCGGCCGCGTCGACCCCGAGCCTCTTCCAGACGAAG
CCGGCAGCTACAGCTGCGCCAGCCACGACTACATCGAGCTTGTTTCCGTCGAAGCCGGCAGTACCACCCACGCCCACCGT
TGCCACAAGCTCTGCCAAGCCTGCCGGAGCTACTGCTACCGGTACAACGGCCACGGCTGCGCCATCGACGACCAGCAGCT
CGACGGCCGGTCCCACTTCACAGCTGGCCCGGTTGAAGAACCGAACCATGGACGAGATCATCAGCCGGTGGGCGACGGAT
CTGGACAAGCACCAGAAAGAGTTCCAGGCGCAGGCTGCCAAGGTGAAGGAATGGGACCAGAAGCTGGTCGAGAACGGCGA
GAAGATCCAGAAGCTCTATCTGGAGACGTACGAGGCTGAGAGGGCCAGCAACGAGATCGACCGCCAGCTGCAGTCGGTAG
AGAGCCAGCAGGACGAGCTGGCCGCTTGGCTGGATCGCTACGAGCGGGAGGCCGAAGAGCTGCTCAGCCGACAGAGCAGC
GGTCCGGGCGAGCAGCTCACGGGCCCGGACCAGGAGCGTGAGCGCACGTACAAGCTGGCTGAGCGGCTGATTGACCGGAT
GGAGGACATGAGCAAGGATATGACCAAGATGATTAAAGAGATCAACGGCATCTCCGGCAGCCTCAGCAAGACGGGCAAGA
CGGATGACCCGGTAAGTACTCTACGAAAGCACGCCCTTTCGAATGGCAAGCTAACCGCTATTTTTTCTCGTGCAGCTGAG
CCAAATTGTCCGTGTCCTCAACGGCCACCTGAGCCAGCTGCAGTGGATCGACACGAACGCGGCAGCACTGCAGAGCAAGG
TGGCAGCGGCAAAGAAGGCAGAGAGCAGCCTGGGCGGACAGTACGGCGGCCTGGAGAACGACGCAGCCGCGAGCTTCTAC
CGGTCGTTTGCAGGACGGCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62