GenePrediction:GLEAN_3117 Details

Name: GLEAN_3117
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:295842..296930 (+ strand)
Length: 1089
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:295842..295902 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_161:295991..296297 (+ strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_161:296367..296608 (+ strand)
Length: 242
Type: CDS
Source: GLEAN
Position: GCSC_161:296670..296740 (+ strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_161:296808..296930 (+ strand)
Length: 123
>GLEAN_3117 class=GenePrediction position=GCSC_161:295842..296930 (+ strand)
ATGGGTCACGAAGATGCCGTCTACCTCGCGAAGCTCGCCGAGCAGGCCGAGCGCTACGAAGGTATTTATTTTCCTCATAC
GACGGTCGTTTCGATGCCGCAGCGACGAGCAATACTGACGCGTGGCTTCTCTTCTCCCCTCTTCTGCAGAAATGGTCGAC
AACATGAAGATTGTCGCTTCCAAAGACCAGGACCTGACCGTCGAGGAGCGCAACCTGCTCTCCGTCGCTTACAAGAACGT
CATCGGCGCACGCCGCGCGTCGTGGAGAATCGTCACTTCCATTGAGCAGAAGGAGGAGTCCAAGGGCAACACCGCCCAGG
TTACCCTCATCAAGGAGTACCGCCAGAAGATCGAGCTCGAGCTCGCCAACATCTGCGAAGACATCCTCAAGGTCCTTGAC
GACCACCTGATCCCCTCTGCCAAGACCGGCGAGTCCAAGGTGTTCTACCACAAGATGTAAGCGCATCATGTTCACCACCC
GTTGCTGTCCGCGGCCATGGCCAAATGACTGACAGCCGCCTGCAGGAAGGGTGACTACCACCGCTACCTCGCCGAGTTTG
CCGTTGGCGACAAGCGCAAGGACTCCGCCGACAAGTCTCTGGAGGCGTACAAGGCTGCCACAGAGGTTGCGCAAACCGAG
CTGCCGCCTACCCACCCCATCCGGCTGGGTCTGGCCCTCAACTTCTCGGTCTTCTACTACGAGATCCTCAACGCTCCGGA
CCAGGCTTGCCACCTGGCCAAGCAGGCATTCGACGACGCCATTGCCGGTACGTCTAGCAGAATCCCGTCTGTCTTGTGGA
TCATGACGCTAATGTGCTCCCATCACAGAACTTGACACACTGAGCGAGGAGAGCTACAAGGACTCGACCCTCATCATGCA
GCTCCTGCGCGATAACCTCGTGAGTTTTTCCCCATGTTCAACCCCTCTCTGCCCCGCAGCTGGACAGCAGATACTGATGC
ATACAGACTCTCTGGACGTCATCTGAGGCCGAGCACGCCGCACCTGCTGCCGAGGCTGCTCCCCAGGAGGAGGCAAAGGC
CGAGGAGGCCGCTGCCCCTGCTGAGGAGGAGCCGAAGGCCGCCGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62