GenePrediction:GLEAN_3119 Details

Name: GLEAN_3119
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:303040..304229 (+ strand)
Length: 1190
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:303040..303168 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_161:303240..304229 (+ strand)
Length: 990
>GLEAN_3119 class=GenePrediction position=GCSC_161:303040..304229 (+ strand)
ATGGCAGCTCCCTCCGACGTCAAGGTGGTGATGCCGTCTATCCTGACCGGGAACAGCTCTCCGCCGATTCTCTCTTCACA
ACGTCGTGCGGCCATCATGGAAGCTGTCGGGGACATTGTCTACGGATCGGTTCGTGCTCGCCTTGGCGCCCTCCTGCGGC
CGTGCTTTGCTTCCAGCTTGTTGCTGACCGTTTTCTCTAGGCTGCCGGTGTGGTCGGCAAGTACATTGAGTATCCCTTTG
ACACGGTCAAAGTCCGCCTGCAGGCCCAACCCGACCATCTGCCGCTGCTGTACAAGGGTCCCATCGACTGCTTTCGCCAG
TCGATCCATGCCGACGGGCTGTTGGGCCTGTACCGGGGCATCAGCGCGCCTCTCGTGGGCGCGGCTCTGGAGACGAGCAG
CCTGTTCACGTTTGAGCGTCTAGGCCGCGAGGCCCTGTTTCGTTCTGGCTACTATTCGCGCGACCGGCCGCTGCCGCTGT
CGGCCCTCTACTTTGCCGGCGCCTTTTCGGGTGCCTTCACGTCGCTCGTCCTGACGCCCATCGAGCTGGTCAAGTGCAAG
ATCCAGGTGCCGGCAGCCCACAACAACGGCGGCAAGCCAGGCCAGACGGAGCACCGTCGCCCGCTGGCCGTCATCCGCGA
GATCTACCGCCACGAGGGTCTGCGCGGGTTCTGGCACGGCCAGCTGGGCACGCTCATCCGCGAGGCCGGCGGCTGTGCGG
CCTGGTTTGGCGGCAAGGAGACGACGACGAGCCTGCTGCGCGAGCTCAACGTCCGGACGGCCCTGGGCGACATGGCCGCA
ACGCCAGCGGCCTCGGAGCTCGAGCAGCTGGAGCGTGCACAGCGGCTGCATCGGCTGCAGCACGACCAGCTGCCGCTGTG
GCAGCAGGCCGTGGCCGGTGCCTCGGCCGGCATGGCCTACAACTTCCTCTTCTTTCCCGCCGACACAGTCAAGTCGCGCA
TGCAGACGACGCCGGTGGGCGCAGGCCTGGGCCTGGGCTTGGGTGCAAACCCGGATGCCGCGTCTCCACAGCGGCGCACC
TTCTTGGCCGAGTCGCAGGCGCTCTGGAAGCAGGCCGGCGTGCGCGGCTTCTACCGGGGCTGCGGTGTGACCGTGTTGCG
GTCGGCACCCAGCTCGGCTTTCATTTTCATGATTTATGATGGGTTGCAGTCGAATTTTCCTTTGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62