GenePrediction:GLEAN_311 Details

Name: GLEAN_311
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:966116..966649 (+ strand)
Length: 534
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:966116..966649 (+ strand)
Length: 534
>GLEAN_311 class=GenePrediction position=GCSC_167:966116..966649 (+ strand)
ATGCCGCGCCAATCCACAGCTGCCACCGGCACCGACGGCGTACCCCACACGACGCGACCCGCCCAGGAAAGCAGCGCCAA
AGTAGCGAAGCCTGCGAGCGGCAAAGGCTCTGGCAAGCGTGGCCGCCCTCCGATGGATCCTACGCAGCGCAAGACGCAGG
CATACGTGCCAACCGGCCGGCCGCGCGGACGCCCCCCCAAAGACCCCTCTCAGAAGAAGAAGTCGGCCACGGCAGCAGAG
CCGACGAGCAAGGCGGCATCCGGATCTGGCCGTGGTCGCGGGCGGCCACCAGGTTCCAAGTCGAAGAAGGCGGCGGCACT
AGCAGACCCAAAACCGGCTGCCTCTGCGACCTTGGCCAAGACGCCCGGGAAGCGCGGCCGCAAGAGCAAGGCGACGCTCG
CTGCAGAAGCAGCAGCTGCAGAAGCAGCACTGGAGGCGACAGAGGCAGCCGGCGTCACCGGTTCTAGTCCTCTGGAAGGG
GATTATGCAGAAGAGGAAGAACAAGAAGACGAGGAAGACGAGTCCAGCGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62