GenePrediction:GLEAN_3120 Details

Name: GLEAN_3120
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:306996..310114 (+ strand)
Length: 3119
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:306996..307110 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_161:307182..309319 (+ strand)
Length: 2138
Type: CDS
Source: GLEAN
Position: GCSC_161:309458..310114 (+ strand)
Length: 657
>GLEAN_3120 class=GenePrediction position=GCSC_161:306996..310114 (+ strand)
ATGGACTCGTATGTCAGAGACTCGGCTCGGTCGCCCCCAGATCGATCCTGGGCCTCTCGTGACGAGAGCAGAGGCAAGGA
CGACCGCGATACATTCTATCGTGGCAGATCTCCAGGTACGAGCGGCTCCCAGCGTTCAGCTGCCTGTTCTAGCTCCCCGA
ACTCCTCCAACCGTCTGACTTTCTAGCCCTAGAGCGAAATCGCCGCACGGCCCGCTCACGCTCCCCGGCAGCTGTTGACC
GCTACGAACCGAGATCCCGCGGAAGGGATGAATATGGTGGTGGACGAGACCGGGACCGTGATGATCGTCGTCGGATTGGA
TCGCCCCCGGCCAATATCGATCGCTACGTACCCGGCCAGTCACAACACCAGTCGCTGCAGCCTCCCCAGGACGGCGGGAT
GGGAGTCCGTCCGCTAATTCACCAGCAGCTGCCCCCGGCAGCGTTTGCAAACCCCATTCCGGACCCGCTGAAACTGCCGT
ACCAGGTCGGATTCTCTTTTTTTGGCGAATGGTGGCGGGCCAACGAGAAGATCAAGGAAGAGAAGGAGTGGCAGAGGACT
GGTCGCCGTCGTGAGCCAGAGCGAAACCGGGGAGCGAAGGAGACACAAGAAGAACGCGAGAAGGAAAAGGCCAGGATCCA
GGCTGCTTATGACTCCTACAAGGAGGAGCTGCAGGGAAAGATGGCGCAGACGTTTGTGAAGCAGCACAAAGAAGAGCAGT
GGTTCCGTGAGCGATACGTACCCGAAATCCGCGAGAAGCTACGCCAGCAGCTAGCTGAATTTCGAAAGGGACAGTTCAGT
CAGTGGGAGCAGGACCTGGAGTCCGGTCTCTTCGACGAGTTCACGTTGGAGGGCATTCCCAAGAATGAGAGCAATGGTGC
CGGCATGACAGAGAAGGAGGAGGGAGAGGCCAACGAAGTTCTGGGCGTCGGCGATCTGGTTCCGGCTGCCACTGCGGCCG
ATATTCGGGACGAGAGCCTCTTCCAGCCAACGCTGCTGATCAAGACGATCGCTCCTAGTGTGAGCCGGCAGAACCTGGAG
ACGTTTTGCCGCGAGCATCTGGGCGTCAACGAGGGTGGTTTCCGGTTCCTGTCCTTGAGCGACCCGAACCCGAGCAAGCG
CTACCACCGGATCGGCTGGATCCTGCTGAACCCTGGGCCAGACGACGGCTTTACCACAGCCGGCGGTCTGCCCGATCCGG
ACAGTCTGGATGGCGATGTGGAGATATCAACTCCGAAGACAATTTCAGTCGCCGACAGGGCTCTGGAGGCCATTAACGGC
AAGACGGTCAAGGACGAGGTACGCGGTGATTTCGTGTGCCATGTCGGCGTTCACAACCCACAGACAAACCCGCGCAGGAA
GGCGCTCTGGGACTTGTTTTCGGCGCCTGAGCGGATCGACAAGGATCTGGGTCTCGTGCAGCGGCTGGTGAACCGATTCG
AGGCCGAGGTGGGATCGGACTTCCAAGGCGTGTTGAAGATTGAGGAGAGAGTGGAAGAGCTGAGACTTGCAGGACGGCTG
CAGTCGTCGGCAGGTACGGGGGCCCAGTCCGGCAACGGCGTCGCGGCTGCTCCGAAGAAGAAGAAGAAGGCCAAGAAGGT
GAGCGTGCTCGGTATGGACGTCGCGGTCGATGACTTTGAGGACCTGGGAGACGAGGTGGACATGGATGATGACGAAGAGG
AAGAAGAAGAGGGCGAAGAGGGTGCGGTGGACGAGGAGGTGGACGACGAGGAGCTGCTGTTGAAGAAGAAGCAGCTTGAC
CTTCTGATCGAATACCTGCGACGGGTTTTCAGTTTCTGCTTTTTCTGTGTGTTTGAGAGCGACTCGGCGCACGAGCTGAC
GCGCAAGTGTCCGGCAGGACATCTGCGGCGGCCACGAGCGACGCTGACGGCAGCGGCCAAGGAGGTGGCGCGAGCCAGTG
CCAGCGGCGAGCCGTTTCCGAGCAAGCGACGCGTGGAAGCGGCAGCGGACGCCGAGGAGGGCGAGCTGCCGCAGGAGGGC
AGCGGTGGAGGTGGCGATCGCAAGTTCCGTGGAGCGTCGGCCAAGTCGGAGCTGCAGCTGCAGCGGGCGTACAACTGGGT
CAGGACGTTTGAGGAGAAGATCAACCAGATTCTGGAGCCGGAATCGGTGGATCTTCGCAAGTACGGCGGCAAGCCGGTGG
ACGAGGCCATGGATGTGGAGATGGCCAAGTACGTGAAGCAAGAGGACGAACACAAGTGGCGATGCCGGCTTCCCGAGTGC
ACGAAGTTGTTCAAGGAGGAGCACTTTTGGCGGAAGCACGTGGAGAAGCGACACACGGAGTGGTGGGAGGCGCTGAAAGA
TGATGTGAGTTTTTGTCCTTTTTGTCTGTTTTTATTTTTTATTTTATTTTTTGTTTGTTTACTTTGGTATTTTGACTTTT
TCTTTCTTTCTTTTTTCTTTTTTTCTTTTTCTTATATTTTCTCCATGATCTAACAGACGCAGATTGAGCTTGTCAATGCC
TACGTGTCGGACCCGTCACACATTGCACCGTCACGAACGGACGCCAACTCCAACGGCCACTTCCCGGCTGCAAACGGACA
GACACCAACAGGGACACCTCGCGGCTTCAGCCTGCAGAGCTATGCGATGAACAGTGTTCTGCCATCAATCCCCGGGTTCT
CTGCACCGGGCCCGTTCAATATGTTCAACCCGGTGGCGATGCAGGTGTCGAACTGGCAGGCAGCGGCCGGCGGTGCTGGC
ATGAGTGCTGCTGGAGGTCCCCTGGGTGACAGCCGTGGACAGGGCCCAATCCGACGAGGAGGACCCGGCAATGGGCGCTA
CAACAATCGGTCTGGTCCGTATGACAGACGGCCTATGCGCTGGAGTCAGGACGGCGGTCTGAACGGCGCTGGAGCGGCGA
TGTATGCTTCTGGCAGCAGTGGTGGTGGCGGTGGATACAGTCGTGGAGGCAGCCGAAACGGCGGAGGTGTCGGTGAATTC
AGCGGCAGTGGAGGTCCTGGTGGTGGTGGACGTTGGGGAGACGGAGCCGGTGGCGGTGCGGCTGTCGGGCCACGCGAGGC
CATCCAGGGCCGTACGATCAAGAGCTACGAAGACCTGGACCAGGTGACGGGTGGTGGAGGCGGCGAGCTCAACTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62