GenePrediction:GLEAN_3121 Details

Name: GLEAN_3121
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:312822..314323 (+ strand)
Length: 1502
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:312822..312824 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_161:312875..312966 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_161:313029..313143 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_161:313214..314323 (+ strand)
Length: 1110
>GLEAN_3121 class=GenePrediction position=GCSC_161:312822..314323 (+ strand)
ATGGTACGTCTCGATGGCCGGTTGCGTTTTCGTCGATTGCTAACATGCAGCAGCCGACCGCACGGGGCCAAGACTGGGAG
AAGTACCAAAAGAAGTTTGCGGACGACGAGATTGAGGAGAAGAAGATTGCGCCGTTGACGGACGAGTGAGTGACAAGGGC
GAGAGGGAGCGAGACGGGTGGTGTGGCTGCTGACCTGTCACTGCTAGGGACATCCAAGTGCTCAAGACATACGGGGCGGC
ACCATATGGCGCAGCCCTGAAGAAGCTGGAACAGCAAATAAAAGAGAAGCAGCAGAGCGTGGACGAGAAGATTGGCGTAA
AGGTGGGTGTGGAGGAGAGCGAAAGCGAACGTGTCTGGACGTGCGGTAGAACAGCCTGCTAACCGGCCACAGGAATCGGA
CACCGGTCTTGCGCCGCCACATCTGTGGGACGTGGCAGCGGACCGGCAGCGAATGTCGGAAGAGCAGCCGCTGCAGGTGG
CGCGGTGCACCAAGATCATTGCGGACGACAGCGACGATGCTAAGAGCAAGTACGTGATCAACGTCAAGCAGATCGCCAAG
TTTGTGGTGCAGCTGGGCGACCGGGTCGCCTCGACCGACATTGAAGAGGGCATGCGGGTGGGCGTGGACCGCAACAAGTA
CCAGATCATGCTGCCGCTGCCGCCCAAGATCGACGCGAGCGTGACGATGATGACGGTGGAGGAGAAGCCGGACGTGACAT
ACGGCGACGTGGGCGGCTGCAAGGAGCAGGTCGAGAAGCTGCGCGAGGTCGTCGAGATGCCGCTGCTGTCGCCCGAGCGC
TTTGTCGATCTGGGCATCGACCCGCCCAAGGGCGTGCTGCTGTACGGGCCACCGGGCACGGGCAAGACGCTGTGTGCGCG
TGCCGTGGCCAACCGCACCGACGCCACCTTTATCCGCGTCATCGGCAGCGAGCTGGTGCAGAAGTACGTCGGCGAGGGCG
CCCGGATGGTGCGCGAGCTGTTCGAGATGGCCCGCACCAAAAAGGCCTGCATCATCTTCTTTGACGAGGTCGACGCCATC
GGTGGCGCCCGCTTCGACGACGGTGCCGGCGGCGACAACGAGGTCCAGCGCACCATGCTCGAGCTCATCACCCAGCTCGA
CGGCTTCGACGCCCGCGGCAACATCAAGGTCATGTTTGCCACCAACCGGCCGTCCACCCTGGATCCGGCCTTGATGCGGC
CCGGTCGCATCGACCGCAAGATCGAGTTCTCCCTGCCCGACCTCGAGGGCCGCGCCAACATTCTGCGCATCCACGCCAAG
AGCATGTCGGTCGAGCGCGATATCCGCTGGGAGCTCATCTCCCGCCTCTGTCCCAACGCCACCGGCGCCGAGCTGCGCAG
TGTCTGCACCGAGGCCGGCATGTTCGCCATCCGCGCCCGTCGCAAGGTCGCCTCCGAAAAGGACTTCCTCAGCGCCGTCG
ACAAGGTCATCAAGGCCAACCTCAAGTTCAACTCCACCGCGTCCTACATGCAGTACAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62