GenePrediction:GLEAN_3122 Details

Name: GLEAN_3122
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:316037..317334 (+ strand)
Length: 1298
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:316037..316911 (+ strand)
Length: 875
Type: CDS
Source: GLEAN
Position: GCSC_161:316968..317334 (+ strand)
Length: 367
>GLEAN_3122 class=GenePrediction position=GCSC_161:316037..317334 (+ strand)
ATGCCGTCCCGATCAGATATCACCTACTTTGGAGCAGGCCCGGCACTGCTGCCGACCGACGTCCTCGAGGATGCGGCGCA
AGCCCTGATCAACTTCAAGGACACCGGTCTGGGCATCGCCGAGCACTCGCACCGCTCCGAGATTGCCACGACGATCATTC
AGGAAGCCAAGGCCGACCTGGCCGCGTACCTCGAGATCCCCGACGACTATGAGATCCTCTTCATGCAGGGCGGCGGCTCG
GGCGAGTTTTCCGCCATGGCCTACAACTTTGTCGGCGCCTGGGTGGCCCGCAAGCAGGCGGCCCTCGGAGCCGGAACAGA
TGGCAGCGCGGCGGAGGCGCTCAAGGCGGCCGTGAAGGACCTCAAGATTGACTACATCGTCACCGGCGGTTGGTCGCAAA
AGGCGTCGGCCGAGGGCGAGCGGCTCTTTGGCGCAGAGCACGTCAACATCGTGGCCGATGGCCGCACGACGACCGGCGGC
AAGTATGGCGTCATCCCGGACGAGAGCACCTGGAACCTGTCCAAGGATGCTGCCATGGTCTACTACTGCGACAACGAGAC
GGTCCATGGGGTCGAGTTTTCCGGCTTCCCTCAGTCTCTCGAGCCGGGCCCGGATGGACCATTTGTCGTTGCCGACATGA
GCTCCAACATTCTCTCTCGCACGATCCCGATCAAGAACTATTCCGCCATCTTCTTCGGCGCCCAGAAGAACCTGGGCTGT
ACCGGCATCACGGTCGTCATCATCAAGAAGTCTTTGCTGCGACAGCCGTCGGCAGAGCTGATGAGAGAGCTGGCTCTGCC
GATTCCGCCTCGGATATTCGAGTTTGAGACTATTGCGAAGAACAACAGCCTCTACAACACGCTGAGCATCTTCGAGTAAG
TGCTGCTGCGCAAGACAGTCGTCGGAGCGAAGCTAATGGCCACCCTCACAGCGTCTACATAGCCGGCCGGGTTCTGAAGA
AGCTGCTGCGCGAGTTCCCCGACAAAGTCCAGGGGCAGGAAGCTGTGTCCGCGAACAAGGCCCAGCTGCTCTATGGCGCC
CTCGAGGCCTATCCCGACGTCTACAAGATCATCCCGGACAAGACCGTGCGGTCGCGCATGAACATCTGCTTCCGCATCGA
GGGGGGCGATGCGGCCGAGGAGGCCTTCCTCAAGCAGGGGGCTGCACTGGGGCTTACCGGGCTGAAAGGTCATCGCGATC
TGCGGGGCATCCGGGCGAGCAATTACAACTCGGTCTCCGTTGATGGAGCGGAGAAGCTTGCCCGCTTCATTGGCGCCTTT
GCGTCGAAACGGCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62