GenePrediction:GLEAN_3123 Details

Name: GLEAN_3123
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:318272..319380 (+ strand)
Length: 1109
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:318272..318309 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_161:318550..318573 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_161:318644..318700 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_161:318755..318882 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_161:318953..318983 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_161:319061..319206 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_161:319268..319380 (+ strand)
Length: 113
>GLEAN_3123 class=GenePrediction position=GCSC_161:318272..319380 (+ strand)
ATGAGTCGCGCAGGCAAACTTGCCCCGGAGGTTAACCGGTGCGTTCCACCCCGTATTTTACCCCGTCGTCAGCTATCATT
TTGTTTCTTTCGGGGCTTGGCAATCGTGTCGGCCGTCTGCCGACACGTCATCATCACGTTGCTATCATGCTTCCCTCCTA
TGGCACTCGCAATTCCTTCCTGTCATCCACCGAATGCTTTTACAGCTTCACTGCTGCTGGTTAGGCCTTGAATTTTTCTA
AATCGCGTCGCTAACAATATGCTTTTTGTCGCGTTCAGAGCTTTATTCGTAAAGAATCTAAGGTTAGTCGAACGTCCTGT
CAACCATCCATCGCCTGCCATCAAGAAAACACGTCGCTGACCTTGCCTACAGCTACAACGTCACTCCCGAGGAGCTCTTT
GAGCTCTTTGGCAAGTTCGGCCCCATTCGGTATGCAACTTTTTGCGTTTCTCCCTCGCTCGGACGACCACTAACAAGTAC
CAGCCAAGTGCGACAGGGTATTGCCAACAATACCAAGGGCACTGCCTTCGTTGTCTATGAAGACGTCATGGATGCAAAGC
AGGCTTGCGATAAGCTGAACGGGTACAACTTCCAGAACCGTTACCTTGTCGGTATGTGCTTACAGCTCCCTTCTCCCATT
CCATTTCTAATCAAGTGCCCTTTTGCTGACTCATCGGGTAGTTCTATACCATCAGCCCGAGAAGATGGCCAAGTCAAAAG
AGGACCTCGAAGTACGCAAGGAGAATTTAGCACAGCTCAAGAAGCAACATGGCATCGATTGACGATTAGACGGGCCTGTG
GACCGCCTGCGAGCAGCATCACCCACGAAGTTGGCTCGACACCCTGCAGGCCCGTCATCTATCACCACCTCCGCACGGCG
TCGATCGTCTGTGTCGTCGACATCGACGACATTGTCGGCATCGTCAACGCTGTCGGTGTCACCTCGCCATGAATTCACCA
TGCCTCTACGCAAAAATACGGCGCCGCCTTCACTAGCGGCGACGACGACCACCAAGAAACTTACCAAGTCGAGCCTCTCC
GATCACGCCCGCGGTGTCATGCCGTATTTCGTGCGCAAGCTCCTCCCCACGGTGTCCGAGGTCGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62